pAd/CMV/V5-DEST

价格:1800元

联系方式:I47-825O-882O

买家导航

载体基本信息

出品公司: Invitrogen
载体名称: pAd/CMV/V5-DEST
质粒类型: Gateway系统载体
高拷贝/低拷贝: 高拷贝
启动子: CMV
克隆方法: 多克隆位点,限制性内切酶
载体大小: 36686bp
5' 测序引物及序列: CMV fwd primer: 5'd[CGCAAATGGGCGGTAGGCGTG]3'
3' 测序引物及序列: V5 rev primer: ACCGAGGAGAGGGTTAGGGAT
载体标签: V5
载体抗性: Ampicillin
筛选标记: --
克隆菌株:
ccdB阳性筛选 DB3.1 感受态细胞,

阴性筛选用 OmniMAX2-T1 感受态细胞,

重组腺病毒载体最好用Stbl2、Stbl3感受态细胞进行质粒的复制和扩增,从常规的DH5a往往会出现拷贝数降低、小提提不出质粒来、质粒大小发生改变等现象。
 
备注:
配套使用入门载体如 pENTR1A pENTR2BpDONR221pDONR201

腺病毒包装可采用Invitrogen出品的293A,也可以bj5183(pAdEasy-1)感受态细胞。
 
产品目录号: V49320
稳定性: 瞬表达
组成型: --
病毒/非病毒: 腺病毒

载体质粒图谱和多克隆位点信息

pAd/CMV/V5 DEST载体图谱



pAd/CMV/V5 Dest多克隆位点

载体简介

载体序列

LOCUS       pAd/CMV/V5-DEST Gateway (ViraPower)	36686 bp 	DNA	SYN
DEFINITION  pAd/CMV/V5-DEST Gateway (ViraPower)
ACCESSION   
KEYWORDS    
SOURCE      
  ORGANISM  other sequences; artificial sequences; vectors.
FEATURES             Location/Qualifiers
     source          1..36686
                     /organism="pAd/CMV/V5 DEST Gateway (ViraPower)"
                     /mol_type="other DNA"
     misc_feature    complement(1..103)
                     /label="RITR"
     misc_feature    1..103
                     /label="LITR"
     misc_feature    183..331
                     /label="Encap"
     promoter        732..1348
                     /label="CMV_immearly_promoter"
     misc_feature    811..1098
                     /label="CAG_enhancer"
     misc_feature    1265..1285
                     /label="CMV_fwd_primer"
     promoter        1359..1377
                     /label="T7_promoter"
     misc_feature    1407..1531
                     /label="attR1"
     misc_feature    complement(1431..1531)
                     /label="attR2"
     misc_feature    complement(1960..2265)
                     /label="ccdB"
     gene            complement(2607..3266)
                     /label="CAT/CamR"
                     /gene="CAT/CamR"
     CDS             complement(2607..3266)
                     /label="ORF frame 1"
                     /translation="MEKKITGYTTVDISQWHRKEHFEAFQSVAQCTYNQTVQLDITAF
                     LKTVKKNKHKFYPAFIHILARLMNAHPEFRMAMKDGELVIWDSVHPCYTVFHEQTETF
                     SSLWSEYHDDFRQFLHIYSQDVACYGENLAYFPKGFIENMFFVSANPWVSFTSFDLNV
                     ANMDNFFAPVFTMGKYYTQGDKVLMPLAIQVHHAVCDGFHVGRMLNELQQYCDEWQGG
                     A*"
     misc_feature    complement(3547..3654)
                     /label="attR1"
                     /translation="MEKKITGYTTVDISQWHRKEHFEAFQSVAQCTYNQTVQLDITAF
                     LKTVKKNKHKFYPAFIHILARLMNAHPEFRMAMKDGELVIWDSVHPCYTVFHEQTETF
                     SSLWSEYHDDFRQFLHIYSQDVACYGENLAYFPKGFIENMFFVSANPWVSFTSFDLNV
                     ANMDNFFAPVFTMGKYYTQGDKVLMPLAIQVHHAVCDGFHVGRMLNELQQYCDEWQGG
                     A*"
     misc_feature    3547..3647
                     /label="attR2"
                     /translation="MEKKITGYTTVDISQWHRKEHFEAFQSVAQCTYNQTVQLDITAF
                     LKTVKKNKHKFYPAFIHILARLMNAHPEFRMAMKDGELVIWDSVHPCYTVFHEQTETF
                     SSLWSEYHDDFRQFLHIYSQDVACYGENLAYFPKGFIENMFFVSANPWVSFTSFDLNV
                     ANMDNFFAPVFTMGKYYTQGDKVLMPLAIQVHHAVCDGFHVGRMLNELQQYCDEWQGG
                     A*"
     terminator      3765..4035
                     /label="TK_PA_terminator"
                     /translation="MEKKITGYTTVDISQWHRKEHFEAFQSVAQCTYNQTVQLDITAF
                     LKTVKKNKHKFYPAFIHILARLMNAHPEFRMAMKDGELVIWDSVHPCYTVFHEQTETF
                     SSLWSEYHDDFRQFLHIYSQDVACYGENLAYFPKGFIENMFFVSANPWVSFTSFDLNV
                     ANMDNFFAPVFTMGKYYTQGDKVLMPLAIQVHHAVCDGFHVGRMLNELQQYCDEWQGG
                     A*"
     CDS             complement(4634..5992)
                     /label="ORF frame 2"
                     /translation="MLPGRRAGRRPAALQHQQDQPQAHPGQRAARSAPLHRDPDYADE
                     DPAPVERHDPGPSGRAPTTAVQRKPPQPAKRGDMLDRDAVEQVTELWDRLELLGQTLK
                     SMPTADGLKPLKNFASLQELLSLGGERLLADLVRENMRVRDMLNEVAPLLRDDGSCSS
                     LNYQLHPVIGVIYGPTGCGKSQLLRNLLSSQLISPTPETVFFIAPQVDMIPPSELKAW
                     EMQICEGNYAPGPDGTIIPQSGTLRPRFVKMAYDDLILEHNYDVSDPRNIFAQAAARG
                     PIAIIMDECMENLGGHKGVSKFFHAFPSKLHDKFPKCTGYTVLVVLHNMNPRRDMAGN
                     IANLKIQSKMHLISPRMHPSQLNRFVNTYTKGLPLAISLLLKDIFRHHAQRSCYDWII
                     YNTTPQHEALQWCYLHPRDGLMPMYLNIQSHLYHVLEKIHRTLNDRDRWSRAYRARKT
                     PK*"
     CDS             complement(5740..8910)
                     /label="ORF frame 3"
                     /translation="MDSSHLRDVVIKLRPPRADIWTLGSRGVVVRSTVTPLEQPDGQG
                     QAAEVEDHQPNPPGEGLKFPLCFLVRGRQVNLVQDVQPVHRCQYCARFYKSQHECSAR
                     RRDFYFHHINSHSSNWWREIQFFPIGSHPRTERLFVTYDVETYTWMGAFGKQLVPFML
                     VMKFGGDEPLVTAARDLAANLGWDRWEQDPLTFYCITPEKMAIGRQFRTFRDHLQMLM
                     ARDLWSSFVASNPHLADWALSEHGLSSPEELTYEELKKLPSIKGIPRFLELYIVGHNI
                     NGFDEIVLAAQVINNRSEVPGPFRITRNFMPRAGKILFNDVTFALPNPRSKKRTDFLL
                     WEQGGCDDTDFKYQYLKVMVRDTFALTHTSLRKAAQAYALPVEKGCCAYQAVNQFYML
                     GSYRSEADGFPIQEYWKDREEFVLNRELWKKKGQDKYDIIKETLDYCALDVQVTAELV
                     NKLRDSYASFVRDAVGLTDASFNVFQRPTISSNSHAIFRQIVFRAEQPARSNLGPDLL
                     APSHELYDYVRASIRGGRCYPTYLGILREPLYVYDICGMYASALTHPMPWGPPLNPYE
                     RALAARAWQQALDLQGCKIDYFDARLLPGVFTVDADPPDETQLDPLPPFCSRKGGRLC
                     WTNERLRGEVATSVDLVTLHNRGWRVHLVPDERTTVFPEWRCVAREYVQLNIAAKERA
                     DRDKNQTLRSIAKLLSNALYGSFATKLDNKKIVFSDQMDAATLKGITAGQVNIKSSSF
                     LETDNLSAEVMPAFQREYSPQQLALADSDAEESEDERAPTPFYSPPSGTPGHVAYTYK
                     PITFLDAEEGDMCLHTLERVDPLVDNDRYPSHLASFVLAWTRAFVSEWSEFLYEEDRG
                     TPLEDRPLKSVYGDTDSLFVTERGHRLMETRGKKRIKKHGGNLVFDPERPELTWLVEC
                     ETVCGACGADAYSPESVFLAPKLYALKSLHCPSCGASSKGKLRAKGHAAEGLDYDTMV
                     KCYLADAQGEDRQRFSTSRTSLKRTLASAQPGAHPFTVTQTTLTRTLRPWKDMTLARL
                     DEHRLLPYSESRPNPRNEEICWIEMP*"
     CDS             complement(9005..9583)
                     /label="ORF frame 2"
                     /translation="MPKGAWSTAASGTREASTPSRSSWPAFPTTSPPPWSEPDAEISR
                     RKRSSSSWPRSPIKTTQETCRRFCARPPSTTPKLILSNSLSGSSSPGPSSSRRGARFR
                     RSTAASSRSPATYARSTSSCPRAAPTCPCPLSRRVRSPPYLRGLARVTAFRCIIQGHP
                     RGPPPAARYRSRAAGMRPLASHRRRHQPAPGN*"
     CDS             complement(9126..11087)
                     /label="ORF frame 1"
                     /translation="MEHFLPLRNIWNRVRDFPRASTTAAGITWMSRYIYGYHRLMLED
                     LAPGAPATLRWPLYRQPPPHFLVGYQYLVRTCNDYVFDSRAYSRLRYTELSQPGHQTV
                     NWSVMANCTYTINTGAYHRFVDMDDFQSTLTQVQQAILAERVVADLALLQPMRGFGVT
                     RMGGRGRHLRPNSAAAAAIDARDAGQEEGEEEVPVERLMQDYYKDLRRCQNEAWGMAD
                     RLRIQQAGPKDMVLLSTIRRLKTAYFNYIISSTSARNNPDRRPLPPATVLSLPCDCDW
                     LDAFLERFSDPVDADSLRSLGGGVPTQQLLRCIVSAVSLPHGSPPPTHNRDMTGGVFQ
                     LRPRENGRAVTETMRRRRGEMIERFVDRLPVRRRRRRVPPPPPPPEEEEGEALMEEEI
                     EEEEEAPVAFEREVRDTVAELIRLLEEELTVSARNSQFFNFAVDFYEAMERLEALGDI
                     NESTLRRWVMYFFVAEHTATTLNYLFQRLRNYAVFARHVELNLAQVVMRARDAEGGVV
                     YSRVWNEGGLNAFSQLMARISNDLAATVERAGRGDLQEEEIEQFMAEIAYQDNSGDVQ
                     EILRQAAVNDTEIDSVELSFRLKLTGPVVFTQRRQIQEINRRVVAFASNLRAQHQLLP
                     ARGADVPLPPLPAGPEPPLPPGARPRHRF*"
     CDS             9847..10353
                     /label="ORF frame 1"
                     /translation="MSSATVSRTSRSKATGASSSSSISSSIRASPSSSSGGGGGGGTR
                     RRRRRTGRRSTKRSIISPRRRRMVSVTARPFSRGRSWKTPPVMSRLWVGGGLPCGRDT
                     ALTMHLNNCCVGTPPPRDLSESASTGSENLSRKASNQSQSQGRLSTVAGGSGRRSGLF
                     LAEVLLMM*"
     CDS             11593..12840
                     /label="ORF frame 1"
                     /translation="MHPVLRQMRPPPQQRQEQEQRQTCRAPSPPPTASGGATSAVDAA
                     ADGDYEPPRRRARHYLDLEEGEGLARLGAPSPERYPRVQLKRDTREAYVPRQNLFRDR
                     EGEEPEEMRDRKFHAGRELRHGLNRERLLREEDFEPDARTGISPARAHVAAADLVTAY
                     EQTVNQEINFQKSFNNHVRTLVAREEVAIGLMHLWDFVSALEQNPNSKPLMAQLFLIV
                     QHSRDNEAFRDALLNIVEPEGRWLLDLINILQSIVVQERSLSLADKVAAINYSMLSLG
                     KFYARKIYHTPYVPIDKEVKIEGFYMRMALKVLTLSDDLGVYRNERIHKAVSVSRRRE
                     LSDRELMHSLQRALAGTGSGDREAESYFDAGADLRWAPSRRALEAAGAGPGLAVAPAR
                     AGNVGGVEEYDEDDEYEPEDGEY*"
     CDS             12861..14618
                     /label="ORF frame 3"
                     /translation="MMQDATDPAVRAALQSQPSGLNSTDDWRQVMDRIMSLTARNPDA
                     FRQQPQANRLSAILEAVVPARANPTHEKVLAIVNALAENRAIRPDEAGLVYDALLQRV
                     ARYNSGNVQTNLDRLVGDVREAVAQRERAQQQGNLGSMVALNAFLSTQPANVPRGQED
                     YTNFVSALRLMVTETPQSEVYQSGPDYFFQTSRQGLQTVNLSQAFKNLQGLWGVRAPT
                     GDRATVSSLLTPNSRLLLLLIAPFTDSGSVSRDTYLGHLLTLYREAIGQAHVDEHTFQ
                     EITSVSRALGQEDTGSLEATLNYLLTNRRQKIPSLHSLNSEEERILRYVQQSVSLNLM
                     RDGVTPSVALDMTARNMEPGMYASNRPFINRLMDYLHRAAAVNPEYFTNAILNPHWLP
                     PPGFYTGGFEVPEGNDGFLWDDIDDSVFSPQPQTLLELQQREQAEAALRKESFRRPSS
                     LSDLGAAAPRSDASSPFPSLIGSLTSTRTTRPRLLGEEEYLNNSLLQPQREKNLPPAF
                     PNNGIESLVDKMSRWKTYAQEHRDVPGPRPPTRRQRHDRQRGLVWEDDDSADDSSVLD
                     LGGSGNPFAHLRPRLGRMF*"
     CDS             14699..16414
                     /label="ORF frame 2"
                     /translation="MRRAAMYEEGPPPSYESVVSAAPVAAALGSPFDAPLDPPFVPPR
                     YLRPTGGRNSIRYSELAPLFDTTRVYLVDNKSTDVASLNYQNDHSNFLTTVIQNNDYS
                     PGEASTQTINLDDRSHWGGDLKTILHTNMPNVNEFMFTNKFKARVMVSRLPTKDNQVE
                     LKYEWVEFTLPEGNYSETMTIDLMNNAIVEHYLKVGRQNGVLESDIGVKFDTRNFRLG
                     FDPVTGLVMPGVYTNEAFHPDIILLPGCGVDFTHSRLSNLLGIRKRQPFQEGFRITYD
                     DLEGGNIPALLDVDAYQASLKDDTEQGGGGAGGSNSSGSGAEENSNAAAAAMQPVEDM
                     NDHAIRGDTFATRAEEKRAEAEAAAEAAAPAAQPEVEKPQKKPVIKPLTEDSKKRSYN
                     LISNDSTFTQYRSWYLAYNYGDPQTGIRSWTLLCTPDVTCGSEQVYWSLPDMMQDPVT
                     FRSTRQISNFPVVGAELLPVHSKSFYNDQAVYSQLIRQFTSLTHVFNRFPENQILARP
                     PAPTITTVSENVPALTDHGTLPLRNSIGGVQRVTITDARRRTCPYVYKALGIVSPRVL
                     SSRTF*"
     CDS             complement(14924..15709)
                     /label="ORF frame 2"
                     /translation="MIVHVLHRLHCRGCRVGVLFRAAATAVAAACATPALFGVIFQAR
                     LVGVHIQQCGNVTTLQIIVGDPKALLEGLPLADAQQVAQAAVGEVHPASWQQNDVWME
                     GFVCIYPRHDKTSDGVKPQSEVAGVKLYPDVAFQNPVLSAHFQVVLHDRVVHKVYGHG
                     LGVVALGQRELHPLVFQLHLIVLSRQARHHHPRLKLIGKHELVHIWHVGMQDGFQVAA
                     PVRPVVKIDGLCACLPRAVVIVLNDRGQKVAVVVLVVQGCHIR*"
     CDS             16421..17017
                     /label="ORF frame 2"
                     /translation="MSILISPSNNTGWGLRFPSKMFGGAKKRSDQHPVRVRGHYRAPW
                     GAHKRGRTGRTTVDDAIDAVVEEARNYTPTPPPVSTVDAAIQTVVRGARRYAKMKRRR
                     RRVARRHRRRPGTAAQRAAAALLNRARRTGRRAAMRAARRLAAGIVTVPPRSRRRAAA
                     AAAAAISAMTQGRRGNVYWVRDSVSGLRVPVRTRPPRN*"
     CDS             17054..18193
                     /label="ORF frame 2"
                     /translation="MYPAAAARNEAMSKRKIKEEMLQVIAPEIYGPPKKEEQDYKPRK
                     LKRVKKKKKDDDDELDDEVELLHATAPRRRVQWKGRRVKRVLRPGTTVVFTPGERSTR
                     TYKRVYDEVYGDEDLLEQANERLGEFAYGKRHKDMLALPLDEGNPTPSLKPVTLQQVL
                     PALAPSEEKRGLKRESGDLAPTVQLMVPKRQRLEDVLEKMTVEPGLEPEVRVRPIKQV
                     APGLGVQTVDVQIPTTSSTSIATATEGMETQTSPVASAVADAAVQAVAAAASKTSTEV
                     QTDPWMFRVSAPRRPRGSRKYGAASALLPEYALHPSIAPTPGYRGYTYRPRRRATTRR
                     RTTTGTRRRRRRRQPVLAPISVRRVAREGGRTLVLPTARYHPSIV*"
     CDS             17829..18308
                     /label="ORF frame 3"
                     /translation="MPRCRRSLRPRPRPLRRCKRTRGCFAFQPPGARAVRGSTAPPAR
                     YCPNMPYILPLRLPPAIVATPTAPEDEQLPDAEPPLEPAAAVAVASPCWPRFPCAGWL
                     AKEAGPWCCQQRATTPASFKSRSLWFLQIWPSPAASVSRCRDSEEECTVGGAWPATA*"
     CDS             18546..19298
                     /label="ORF frame 3"
                     /translation="MEDINFASLAPRHGSRPFMGNWQDIGTSNMSGGAFSWGSLWSGI
                     KNFGSTVKNYGSKAWNSSTGQMLRDKLKEQNFQQKVVDGLASGISGVVDLANQAVQNK
                     INSKLDPRPPVEEPPPAVETVSPEGRGEKRPRPDREETLVTQIDEPPSYEEALKQGLP
                     TTRPIAPMATGVLGQHTPVTLDLPPPADTQQKPVLPGPTAVVVTRPSRASLRRAASGP
                     RSLRPVASGNWQSTLNSIVGLGVQSLKRRRCF*"
     CDS             complement(18704..19252)
                     /label="ORF frame 2"
                     /translation="MLFSVLCQLPLATGRNDRGPLAARRRDARLGRVTTTAVGPGSTG
                     FCWVSAGGGRSSVTGVCWPSTPVAMGAMGRVVGRPCFSASSYEGGSSICVTRVSSLSG
                     RGRFSPRPSGDTVSTAGGGSSTGGRGSSLLLILFCTAWLARSTTPLMPEARPSTTFCW
                     KFCSFNLSLSIWPVLLFQALLP*"
     CDS             19385..22243
                     /label="ORF frame 2"
                     /translation="MATPSMMPQWSYMHISGQDASEYLSPGLVQFARATETYFSLNNK
                     FRNPTVAPTHDVTTDRSQRLTLRFIPVDREDTAYSYKARFTLAVGDNRVLDMASTYFD
                     IRGVLDRGPTFKPYSGTAYNALAPKGAPNPCEWDEAATALEINLEEEDDDNEDEVDEQ
                     AEQQKTHVFGQAPYSGINITKEGIQIGVEGQTPKYADKTFQPEPQIGESQWYETEINH
                     AAGRVLKKTTPMKPCYGSYAKPTNENGGQGILVKQQNGKLESQVEMQFFSTTEATAGN
                     GDNLTPKVVLYSEDVDIETPDTHISYMPTIKEGNSRELMGQQSMPNRPNYIAFRDNFI
                     GLMYYNSTGNMGVLAGQASQLNAVVDLQDRNTELSYQLLLDSIGDRTRYFSMWNQAVD
                     SYDPDVRIIENHGTEDELPNYCFPLGGVINTETLTKVKPKTGQENGWEKDATEFSDKN
                     EIRVGNNFAMEINLNANLWRNFLYSNIALYLPDKLKYSPSNVKISDNPNTYDYMNKRV
                     VAPGLVDCYINLGARWSLDYMDNVNPFNHHRNAGLRYRSMLLGNGRYVPFHIQVPQKF
                     FAIKNLLLLPGSYTYEWNFRKDVNMVLQSSLGNDLRVDGASIKFDSICLYATFFPMAH
                     NTASTLEAMLRNDTNDQSFNDYLSAANMLYPIPANATNVPISIPSRNWAAFRGWAFTR
                     LKTKETPSLGSGYDPYYTYSGSIPYLDGTFYLNHTFKKVAITFDSSVSWPGNDRLLTP
                     NEFEIKRSVDGEGYNVAQCNMTKDWFLVQMLANYNIGYQGFYIPESYKDRMYSFFRNF
                     QPMSRQVVDDTKYKDYQQVGILHQHNNSGFVGYLAPTMREGQAYPANFPYPLIGKTAV
                     DSITQKKFLCDRTLWRIPFSSNFMSMGALTDLGQNLLYANSAHALDMTFEVDPMDEPT
                     LLYVLFEVFDVVRVHRPHRGVIETVYLRTPFSAGNATT*"
     CDS             22276..22890
                     /label="ORF frame 1"
                     /translation="MGSSEQELKAIVKDLGCGPYFLGTYDKRFPGFVSPHKLACAIVN
                     TAGRETGGVHWMAFAWNPHSKTCYLFEPFGFSDQRLKQVYQFEYESLLRRSAIASSPD
                     RCITLEKSTQSVQGPNSAACGLFCCMFLHAFANWPQTPMDHNPTMNLITGVPNSMLNS
                     PQVQPTLRRNQEQLYSFLERHSPYFRSHSAQIRSATSFCHLKNM*"
     CDS             complement(22986..24575)
                     /label="ORF frame 1"
                     /translation="MASREEEQRETTPERGRGAARRPPTMEDVSSPSPSPPPPRAPPK
                     KRMRRRIESEDEEDSSQDALVPRTPSPRPSTSAADLAIAPKKKKKRPSPKPERPPSPE
                     VIVDSEEEREDVALQMVGFSNPPVLIKHGKGGKRTVRRLNEDDPVARGMRTQEEEEEP
                     SEAESEITVMNPLSVPIVSAWEKGMEAARALMDKYHVDNDLKANFKLLPDQVEALAAV
                     CKTWLNEEHRGLQLTFTSNKTFVTMMGRFLQAYLQSFAEVTYKHHEPTGCALWLHRCA
                     EIEGELKCLHGSIMINKEHVIEMDVTSENGQRALKEQSSKAKIVKNRWGRNVVQISNT
                     DARCCVHDAACPANQFSGKSCGMFFSEGAKAQVAFKQIKAFMQALYPNAQTGHGHLLM
                     PLRCECNSKPGHAPFLGRQLPKLTPFALSNAEDLDADLISDKSVLASVHHPALIVFQC
                     CNPVYRNSRAQGGGPNCDFKISAPDLLNALVMVRSLWSENFTELPRMVVPEFKWSTKH
                     QYRNVSLPVAHSDARQNPFDF*"
     CDS             24022..27027
                     /label="ORF frame 1"
                     /translation="MPFSHADTIGTLSGFITVISLSASLGSSSSSCVRIPRATGSSSF
                     SRRTVRLPPLPCLISTGGLLKPTICSATSSLSSSLSTITSGDGGRSGLGEGRFFFFLG
                     AMAKSAAEVDGRGLGVRGTSASCDESSSSSDSIRRLIRFFGGARGGGGDGDGDDTSSM
                     VGGRRAAPRPRSGVVSRCSSSRLAISFSYRQKKIMESVEKKDSLTAPSEFATTASTDA
                     ANAPTTFPVEAPPLEEEEVIIEQDPGFVSEDDEDRSVPTEDKKQDQDNAEANEEQVGR
                     GDERHGDYLDVGDDVLLKHLQRQCAIICDALQERSDVPLAIADVSLAYERHLFSPRVP
                     PKRQENGTCEPNPRLNFYPVFAVPEVLATYHIFFQNCKIPLSCRANRSRADKQLALRQ
                     GAVIPDIASLNEVPKIFEGLGRDEKRAANALQQENSENESHSGVLVELEGDNARLAVL
                     KRSIEVTHFAYPALNLPPKVMSTVMSELIVRRAQPLERDANLQEQTEEGLPAVGDEQL
                     ARWLQTREPADLEERRKLMMAAVLVTVELECMQRFFADPEMQRKLEETLHYTFRQGYV
                     RQACKISNVELCNLVSYLGILHENRLGQNVLHSTLKGEARRDYVRDCVYLFLCYTWQT
                     AMGVWQQCLEECNLKELQKLLKQNLKDLWTAFNERSVAAHLADIIFPERLLKTLQQGL
                     PDFTSQSMLQNFRNFILERSGILPATCCALPSDFVPIKYRECPPPLWGHCYLLQLANY
                     LAYHSDIMEDVSGDGLLECHCRCNLCTPHRSLVCNSQLLNESQIIGTFELQGPSPDEK
                     SAAPGLKLTPGLWTSAYLRKFVPEDYHAHEIRFYEDQSRPPNAELTACVITQGHILGQ
                     LQAINKARQEFLLRKGRGVYLDPQSGEELNPIPPPPQPYQQQPRALASQDGTQKEAAA
                     AAATHGRGGILGQSGRGGFGRGGGGHDGRLGEPRRGSFRGRRGVRRNTVTLGRIPLAG
                     APEIGNRFQHGYNLRSSGAAGTARSPTQP*"
     CDS             26540..27328
                     /label="ORF frame 2"
                     /translation="MRSLPPASLPRATFLANCKPSTKPAKSFCYERDGGFTWTPSPAR
                     SSTQSPRRRSPISSSRGPLLPRMAPKKKLQLPPPPTDEEEYWDSQAEEVLDEEEEDMM
                     EDWESLDEEASEVEEVSDETPSPSVAFPSPAPQKSATGSSMATTSAPQAPPALPVRRP
                     NRRWDTTGTRAGKSKQPPPLAQEQQQRQGYRSWRGHKNAIVACLQDCGGNISFARRFL
                     LYHHGVAFPRNILHYYRHLYSPYCTGGSGSGSNSSGHTEAKATG*"
     CDS             27717..28400
                     /label="ORF frame 3"
                     /translation="MSKEIPTPYMWSYQPQMGLAAGAAQDYSTRINYMSAGPHMISRV
                     NGIRAHRNRILLEQAAITTTPRNNLNPRSWPAALVYQESPAPTTVVLPRDAQAEVQMT
                     NSGAQLAGGFRHRVRSPGQGITHLTIRGRGIQLNDESVSSSLGLRPDGTFQIGGAGRP
                     SFTPRQAILTLQTSSSEPRSGGIGTLQFIEEFVPSVYFNPFSGPPGHYPDQFIPNFDA
                     VKDSADGYD*"
     CDS             29650..31452
                     /label="ORF frame 1"
                     /translation="MSVSSCSCPSAPTIFMLLQMKRARPSEDTFNPVYPYDTETGPPT
                     VPFLTPPFVSPNGFQESPPGVLSLRLSEPLVTSNGMLALKMGNGLSLDEAGNLTSQNV
                     TTVSPPLKKTKSNINLEISAPLTVTSEALTVAAAAPLMVAGNTLTMQSQAPLTVHDSK
                     LSIATQGPLTVSEGKLALQTSGPLTTTDSSTLTITASPPLTTATGSLGIDLKEPIYTQ
                     NGKLGLKYGAPLHVTDDLNTLTVATGPGVTINNTSLQTKVTGALGFDSQGNMQLNVAG
                     GLRIDSQNRRLILDVSYPFDAQNQLNLRLGQGPLFINSAHNLDINYNKGLYLFTASNN
                     SKKLEVNLSTAKGLMFDATAIAINAGDGLEFGSPNAPNTNPLKTKIGHGLEFDSNKAM
                     VPKLGTGLSFDSTGAITVGNKNNDKLTLWTTPAPSPNCRLNAEKDAKLTLVLTKCGSQ
                     ILATVSVLAVKGSLAPISGTVQSAHLIIRFDENGVLLNNSFLDPEYWNFRNGDLTEGT
                     AYTNAVGFMPNLSAYPKSHGKTAKSNIVSQVYLNGDKTKPVTLTITLNGTQETGDTTP
                     SAYSMSFSWDWSGHNYINEIFATSSYTFSYIAQE*"
     CDS             complement(29823..30293)
                     /label="ORF frame 1"
                     /translation="MGSFKSMPKLPVAVVRGGEAVIVRVLLSVVVRGPDVCRASFPSD
                     TVRGPWVAMLSLESCTVSGACDCMVSVLPATIRGAAAATVRASEVTVRGADISRFMFD
                     LVFLRGGLTVVTFWEVRLPASSRERPLPILSASMPLEVTRGSDRRKESTPGGLS*"
     CDS             complement(31858..32742)
                     /label="ORF frame 3"
                     /translation="MTTSGVPFGMTLRPTRSRLSRRTPYSRDRLPPFETETRATILED
                     HPLLPECNTLTMHNVSYVRGLPCSVGFTLIQEWVVPWDMVLTREELVILRKCMHVCLC
                     CANIDIMTSMMIHGYESWALHCHCSSPGSLQCIAGGQVLASWFRMVVDGAMFNQRFIW
                     YREVVNYNMPKEVMFMSSVFMRGRHLIYLRLWYDGHVGSVVPAMSFGYSALHCGILNN
                     IVVLCCSYCADLSEIRVRCCARRTRRLMLRAVRIIAEETTAMLYSCRTERRRQQFIRA
                     LLQHHRPILMHDYDSTPM*"
     CDS             32621..33118
                     /label="ORF frame 2"
                     /translation="MVARVSVSKGGRRSLLYGVRRDNRDRVGRSVMPNGTPDVVIFPE
                     AKPGAGVTNRSASPVSPLRSLCVVVVVYPLSQSIQAPPGFGFYVNSFMRRCPDNIHHR
                     RISHTQPTYTFVLRVTHGRSGKSWKNHVFFFIPKDYPKPQNEDLLSERAPLRWRGQTL
                     QPKNR*"
     misc_feature    complement(34502..34604)
                     /label="LITR"
                     /translation="MVARVSVSKGGRRSLLYGVRRDNRDRVGRSVMPNGTPDVVIFPE
                     AKPGAGVTNRSASPVSPLRSLCVVVVVYPLSQSIQAPPGFGFYVNSFMRRCPDNIHHR
                     RISHTQPTYTFVLRVTHGRSGKSWKNHVFFFIPKDYPKPQNEDLLSERAPLRWRGQTL
                     QPKNR*"
     misc_feature    34502..34604
                     /label="RITR"
                     /translation="MVARVSVSKGGRRSLLYGVRRDNRDRVGRSVMPNGTPDVVIFPE
                     AKPGAGVTNRSASPVSPLRSLCVVVVVYPLSQSIQAPPGFGFYVNSFMRRCPDNIHHR
                     RISHTQPTYTFVLRVTHGRSGKSWKNHVFFFIPKDYPKPQNEDLLSERAPLRWRGQTL
                     QPKNR*"
     rep_origin      complement(34813..35432)
                     /label="pBR322_origin"
                     /translation="MVARVSVSKGGRRSLLYGVRRDNRDRVGRSVMPNGTPDVVIFPE
                     AKPGAGVTNRSASPVSPLRSLCVVVVVYPLSQSIQAPPGFGFYVNSFMRRCPDNIHHR
                     RISHTQPTYTFVLRVTHGRSGKSWKNHVFFFIPKDYPKPQNEDLLSERAPLRWRGQTL
                     QPKNR*"
     gene            complement(35568..36428)
                     /label="Ampicillin"
                     /gene="Ampicillin"
                     /translation="MVARVSVSKGGRRSLLYGVRRDNRDRVGRSVMPNGTPDVVIFPE
                     AKPGAGVTNRSASPVSPLRSLCVVVVVYPLSQSIQAPPGFGFYVNSFMRRCPDNIHHR
                     RISHTQPTYTFVLRVTHGRSGKSWKNHVFFFIPKDYPKPQNEDLLSERAPLRWRGQTL
                     QPKNR*"
     CDS             complement(35568..36428)
                     /label="ORF frame 1"
                     /translation="MSIQHFRVALIPFFAAFCLPVFAHPETLVKVKDAEDQLGARVGY
                     IELDLNSGKILESFRPEERFPMMSTFKVLLCGAVLSRVDAGQEQLGRRIHYSQNDLVE
                     YSPVTEKHLTDGMTVRELCSAAITMSDNTAANLLLTTIGGPKELTAFLHNMGDHVTRL
                     DRWEPELNEAIPNDERDTTMPA?MATTLRKLLTGELLTLASRQQLIDWMEADKVAGPL
                     LRSALPAGWFIADKSGAGERGSRGIIAALGPDGKPSRIVVIYTTGSQATMDERNRQIA
                     EIGASLIKHW*"
     promoter        complement(36470..36498)
                     /label="AmpR_promoter"
                     /translation="MSIQHFRVALIPFFAAFCLPVFAHPETLVKVKDAEDQLGARVGY
                     IELDLNSGKILESFRPEERFPMMSTFKVLLCGAVLSRVDAGQEQLGRRIHYSQNDLVE
                     YSPVTEKHLTDGMTVRELCSAAITMSDNTAANLLLTTIGGPKELTAFLHNMGDHVTRL
                     DRWEPELNEAIPNDERDTTMPA?MATTLRKLLTGELLTLASRQQLIDWMEADKVAGPL
                     LRSALPAGWFIADKSGAGERGSRGIIAALGPDGKPSRIVVIYTTGSQATMDERNRQIA
                     EIGASLIKHW*"
ORIGIN
    1 CATCATCAAT AATATACCTT ATTTTGGATT GAAGCCAATA TGATAATGAG GGGGTGGAGT
   61 TTGTGACGTG GCGCGGGGCG TGGGAACGGG GCGGGTGACG TAGTAGTGTG GCGGAAGTGT
  121 GATGTTGCAA GTGTGGCGGA ACACATGTAA GCGACGGATG TGGCAAAAGT GACGTTTTTG
  181 GTGTGCGCCG GTGTACACAG GAAGTGACAA TTTTCGCGCG GTTTTAGGCG GATGTTGTAG
  241 TAAATTTGGG CGTAACCGAG TAAGATTTGG CCATTTTCGC GGGAAAACTG AATAAGAGGA
  301 AGTGAAATCT GAATAATTTT GTGTTACTCA TAGCGCGTAA TATTTGTCTA GGGCCGCGGG
  361 GACTTTGACC GTTTACGTGG AGACTCGCCC AGGTGTTTTT CTCAGGTGTT TTCCGCGTTC
  421 CGGGTCAAAG TTGGCGTTTT ATTATTATAG TCAGTCGAAG CTTGGATCCG GTACCTCTAG
  481 AATTCTCGAG CGGCCGCTAG CGACATCGGA TCTCCCGATC CCCTATGGTC GACTCTCAGT
  541 ACAATCTGCT CTGATGCCGC ATAGTTAAGC CAGTATCTGC TCCCTGCTTG TGTGTTGGAG
  601 GTCGCTGAGT AGTGCGCGAG CAAAATTTAA GCTACAACAA GGCAAGGCTT GACCGACAAT
  661 TGCATGAAGA ATCTGCTTAG GGTTAGGCGT TTTGCGCTGC TTCGCGATGT ACGGGCCAGA
  721 TATACGCGTT GACATTGATT ATTGACTAGT TATTAATAGT AATCAATTAC GGGGTCATTA
  781 GTTCATAGCC CATATATGGA GTTCCGCGTT ACATAACTTA CGGTAAATGG CCCGCCTGGC
  841 TGACCGCCCA ACGACCCCCG CCCATTGACG TCAATAATGA CGTATGTTCC CATAGTAACG
  901 CCAATAGGGA CTTTCCATTG ACGTCAATGG GTGGACTATT TACGGTAAAC TGCCCACTTG
  961 GCAGTACATC AAGTGTATCA TATGCCAAGT ACGCCCCCTA TTGACGTCAA TGACGGTAAA
 1021 TGGCCCGCCT GGCATTATGC CCAGTACATG ACCTTATGGG ACTTTCCTAC TTGGCAGTAC
 1081 ATCTACGTAT TAGTCATCGC TATTACCATG GTGATGCGGT TTTGGCAGTA CATCAATGGG
 1141 CGTGGATAGC GGTTTGACTC ACGGGGATTT CCAAGTCTCC ACCCCATTGA CGTCAATGGG
 1201 AGTTTGTTTT GGCACCAAAA TCAACGGGAC TTTCCAAAAT GTCGTAACAA CTCCGCCCCA
 1261 TTGACGCAAA TGGGCGGTAG GCGTGTACGG TGGGAGGTCT ATATAAGCAG AGCTCTCTGG
 1321 CTAACTAGAG AACCCACTGC TTACTGGCTT ATCGAAATTA ATACGACTCA CTATAGGGAG
 1381 ACCCAAGCTG GCTAGTTAAG CTATCAACAA GTTTGTACAA AAAAGCTGAA CGAGAAACGT
 1441 AAAATGATAT AAATATCAAT ATATTAAATT AGATTTTGCA TAAAAAACAG ACTACATAAT
 1501 ACTGTAAAAC ACAACATATC CAGTCACTAT GAATCAACTA CTTAGATGGT ATTAGTGACC
 1561 TGTAGTCGAC CGACAGCCTT CCAAATGTTC TTCGGGTGAT GCTGCCAACT TAGTCGACCG
 1621 ACAGCCTTCC AAATGTTCTT CTCAAACGGA ATCGTCGTAT CCAGCCTACT CGCTATTGTC
 1681 CTCAATGCCG TATTAAATCA TAAAAAGAAA TAAGAAAAAG AGGTGCGAGC CTCTTTTTTG
 1741 TGTGACAAAA TAAAAACATC TACCTATTCA TATACGCTAG TGTCATAGTC CTGAAAATCA
 1801 TCTGCATCAA GAACAATTTC ACAACTCTTA TACTTTTCTC TTACAAGTCG TTCGGCTTCA
 1861 TCTGGATTTT CAGCCTCTAT ACTTACTAAA CGTGATAAAG TTTCTGTAAT TTCTACTGTA
 1921 TCGACCTGCA GACTGGCTGT GTATAAGGGA GCCTGACATT TATATTCCCC AGAACATCAG
 1981 GTTAATGGCG TTTTTGATGT CATTTTCGCG GTGGCTGAGA TCAGCCACTT CTTCCCCGAT
 2041 AACGGAGACC GGCACACTGG CCATATCGGT GGTCATCATG CGCCAGCTTT CATCCCCGAT
 2101 ATGCACCACC GGGTAAAGTT CACGGGAGAC TTTATCTGAC AGCAGACGTG CACTGGCCAG
 2161 GGGGATCACC ATCCGTCGCC CGGGCGTGTC AATAATATCA CTCTGTACAT CCACAAACAG
 2221 ACGATAACGG CTCTCTCTTT TATAGGTGTA AACCTTAAAC TGCATTTCAC CAGTCCCTGT
 2281 TCTCGTCAGC AAAAGAGCCG TTCATTTCAA TAAACCGGGC GACCTCAGCC ATCCCTTCCT
 2341 GATTTTCCGC TTTCCAGCGT TCGGCACGCA GACGACGGGC TTCATTCTGC ATGGTTGTGC
 2401 TTACCAGACC GGAGATATTG ACATCATATA TGCCTTGAGC AACTGATAGC TGTCGCTGTC
 2461 AACTGTCACT GTAATACGCT GCTTCATAGC ACACCTCTTT TTGACATACT TCGGGTATAC
 2521 ATATCAGTAT ATATTCTTAT ACCGCAAAAA TCAGCGCGCA AATACGCATA CTGTTATCTG
 2581 GCTTTTAGTA AGCCGGATCC ACGCGATTAC GCCCCGCCCT GCCACTCATC GCAGTACTGT
 2641 TGTAATTCAT TAAGCATTCT GCCGACATGG AAGCCATCAC AGACGGCATG ATGAACCTGA
 2701 ATCGCCAGCG GCATCAGCAC CTTGTCGCCT TGCGTATAAT ATTTGCCCAT GGTGAAAACG
 2761 GGGGCGAAGA AGTTGTCCAT ATTGGCCACG TTTAAATCAA AACTGGTGAA ACTCACCCAG
 2821 GGATTGGCTG AGACGAAAAA CATATTCTCA ATAAACCCTT TAGGGAAATA GGCCAGGTTT
 2881 TCACCGTAAC ACGCCACATC TTGCGAATAT ATGTGTAGAA ACTGCCGGAA ATCGTCGTGG
 2941 TATTCACTCC AGAGCGATGA AAACGTTTCA GTTTGCTCAT GGAAAACGGT GTAACAAGGG
 3001 TGAACACTAT CCCATATCAC CAGCTCACCG TCTTTCATTG CCATACGGAA TTCCGGATGA
 3061 GCATTCATCA GGCGGGCAAG AATGTGAATA AAGGCCGGAT AAAACTTGTG CTTATTTTTC
 3121 TTTACGGTCT TTAAAAAGGC CGTAATATCC AGCTGAACGG TCTGGTTATA GGTACATTGA
 3181 GCAACTGACT GAAATGCCTC AAAATGTTCT TTACGATGCC ATTGGGATAT ATCAACGGTG
 3241 GTATATCCAG TGATTTTTTT CTCCATTTTA GCTTCCTTAG CTCCTGAAAA TCTCGATAAC
 3301 TCAAAAAATA CGCCCGGTAG TGATCTTATT TCATTATGGT GAAAGTTGGA ACCTCTTACG
 3361 TGCCGATCAA CGTCTCATTT TCGCCAAAAG TTGGCCCAGG GCTTCCCGGT ATCAACAGGG
 3421 ACACCAGGAT TTATTTATTC TGCGAAGTGA TCTTCCGTCA CAGGTATTTA TTCGGCGCAA
 3481 AGTGCGTCGG GTGATGCTGC CAACTTAGTC GACTACAGGT CACTAATACC ATCTAAGTAG
 3541 TTGATTCATA GTGACTGGAT ATGTTGTGTT TTACAGTATT ATGTAGTCTG TTTTTTATGC
 3601 AAAATCTAAT TTAATATATT GATATTTATA TCATTTTACG TTTCTCGTTC AGCTTTCTTG
 3661 TACAAAGTGG TTGATCTAGA GGGCCCGCGG TTCGAAGGTA AGCCTATCCC TAACCCTCTC
 3721 CTCGGTCTCG ATTCTACGCG TACCGGTTAG TAATGAGTTT AAACGGGGGA GGCTAACTGA
 3781 AACACGGAAG GAGACAATAC CGGAAGGAAC CCGCGCTATG ACGGCAATAA AAAGACAGAA
 3841 TAAAACGCAC GGGTGTTGGG TCGTTTGTTC ATAAACGCGG GGTTCGGTCC CAGGGCTGGC
 3901 ACTCTGTCGA TACCCCACCG AGACCCCATT GGGGCCAATA CGCCCGCGTT TCTTCCTTTT
 3961 CCCCACCCCA CCCCCCAAGT TCGGGTGAAG GCCCAGGGCT CGCAGCCAAC GTCGGGGCGG
 4021 CAGGCCCTGC CATAGCAGAT CCGATTCGAC AGATCACTGA AATGTGTGGG CGTGGCTTAA
 4081 GGGTGGGAAA GAATATATAA GGTGGGGGTC TTATGTAGTT TTGTATCTGT TTTGCAGCAG
 4141 CCGCCGCCGC CATGAGCACC AACTCGTTTG ATGGAAGCAT TGTGAGCTCA TATTTGACAA
 4201 CGCGCATGCC CCCATGGGCC GGGGTGCGTC AGAATGTGAT GGGCTCCAGC ATTGATGGTC
 4261 GCCCCGTCCT GCCCGCAAAC TCTACTACCT TGACCTACGA GACCGTGTCT GGAACGCCGT
 4321 TGGAGACTGC AGCCTCCGCC GCCGCTTCAG CCGCTGCAGC CACCGCCCGC GGGATTGTGA
 4381 CTGACTTTGC TTTCCTGAGC CCGCTTGCAA GCAGTGCAGC TTCCCGTTCA TCCGCCCGCG
 4441 ATGACAAGTT GACGGCTCTT TTGGCACAAT TGGATTCTTT GACCCGGGAA CTTAATGTCG
 4501 TTTCTCAGCA GCTGTTGGAT CTGCGCCAGC AGGTTTCTGC CCTGAAGGCT TCCTCCCCTC
 4561 CCAATGCGGT TTAAAACATA AATAAAAAAC CAGACTCTGT TTGGATTTGG ATCAAGCAAG
 4621 TGTCTTGCTG TCTTTATTTA GGGGTTTTGC GCGCGCGGTA GGCCCGGGAC CAGCGGTCTC
 4681 GGTCGTTGAG GGTCCTGTGT ATTTTTTCCA GGACGTGGTA AAGGTGACTC TGGATGTTCA
 4741 GATACATGGG CATAAGCCCG TCTCTGGGGT GGAGGTAGCA CCACTGCAGA GCTTCATGCT
 4801 GCGGGGTGGT GTTGTAGATG ATCCAGTCGT AGCAGGAGCG CTGGGCGTGG TGCCTAAAAA
 4861 TGTCTTTCAG TAGCAAGCTG ATTGCCAGGG GCAGGCCCTT GGTGTAAGTG TTTACAAAGC
 4921 GGTTAAGCTG GGATGGGTGC ATACGTGGGG ATATGAGATG CATCTTGGAC TGTATTTTTA
 4981 GGTTGGCTAT GTTCCCAGCC ATATCCCTCC GGGGATTCAT GTTGTGCAGA ACCACCAGCA
 5041 CAGTGTATCC GGTGCACTTG GGAAATTTGT CATGTAGCTT AGAAGGAAAT GCGTGGAAGA
 5101 ACTTGGAGAC GCCCTTGTGA CCTCCAAGAT TTTCCATGCA TTCGTCCATA ATGATGGCAA
 5161 TGGGCCCACG GGCGGCGGCC TGGGCGAAGA TATTTCTGGG ATCACTAACG TCATAGTTGT
 5221 GTTCCAGGAT GAGATCGTCA TAGGCCATTT TTACAAAGCG CGGGCGGAGG GTGCCAGACT
 5281 GCGGTATAAT GGTTCCATCC GGCCCAGGGG CGTAGTTACC CTCACAGATT TGCATTTCCC
 5341 ACGCTTTGAG TTCAGATGGG GGGATCATGT CTACCTGCGG GGCGATGAAG AAAACGGTTT
 5401 CCGGGGTAGG GGAGATCAGC TGGGAAGAAA GCAGGTTCCT GAGCAGCTGC GACTTACCGC
 5461 AGCCGGTGGG CCCGTAAATC ACACCTATTA CCGGGTGCAA CTGGTAGTTA AGAGAGCTGC
 5521 AGCTGCCGTC ATCCCTGAGC AGGGGGGCCA CTTCGTTAAG CATGTCCCTG ACTCGCATGT
 5581 TTTCCCTGAC CAAATCCGCC AGAAGGCGCT CGCCGCCCAG CGATAGCAGT TCTTGCAAGG
 5641 AAGCAAAGTT TTTCAACGGT TTGAGACCGT CCGCCGTAGG CATGCTTTTG AGCGTTTGAC
 5701 CAAGCAGTTC CAGGCGGTCC CACAGCTCGG TCACCTGCTC TACGGCATCT CGATCCAGCA
 5761 TATCTCCTCG TTTCGCGGGT TGGGGCGGCT TTCGCTGTAC GGCAGTAGTC GGTGCTCGTC
 5821 CAGACGGGCC AGGGTCATGT CTTTCCACGG GCGCAGGGTC CTCGTCAGCG TAGTCTGGGT
 5881 CACGGTGAAG GGGTGCGCTC CGGGCTGCGC GCTGGCCAGG GTGCGCTTGA GGCTGGTCCT
 5941 GCTGGTGCTG AAGCGCTGCC GGTCTTCGCC CTGCGCGTCG GCCAGGTAGC ATTTGACCAT
 6001 GGTGTCATAG TCCAGCCCCT CCGCGGCGTG GCCCTTGGCG CGCAGCTTGC CCTTGGAGGA
 6061 GGCGCCGCAC GAGGGGCAGT GCAGACTTTT GAGGGCGTAG AGCTTGGGCG CGAGAAATAC
 6121 CGATTCCGGG GAGTAGGCAT CCGCGCCGCA GGCCCCGCAG ACGGTCTCGC ATTCCACGAG
 6181 CCAGGTGAGC TCTGGCCGTT CGGGGTCAAA AACCAGGTTT CCCCCATGCT TTTTGATGCG
 6241 TTTCTTACCT CTGGTTTCCA TGAGCCGGTG TCCACGCTCG GTGACGAAAA GGCTGTCCGT
 6301 GTCCCCGTAT ACAGACTTGA GAGGCCTGTC CTCGAGCGGT GTTCCGCGGT CCTCCTCGTA
 6361 TAGAAACTCG GACCACTCTG AGACAAAGGC TCGCGTCCAG GCCAGCACGA AGGAGGCTAA
 6421 GTGGGAGGGG TAGCGGTCGT TGTCCACTAG GGGGTCCACT CGCTCCAGGG TGTGAAGACA
 6481 CATGTCGCCC TCTTCGGCAT CAAGGAAGGT GATTGGTTTG TAGGTGTAGG CCACGTGACC
 6541 GGGTGTTCCT GAAGGGGGGC TATAAAAGGG GGTGGGGGCG CGTTCGTCCT CACTCTCTTC
 6601 CGCATCGCTG TCTGCGAGGG CCAGCTGTTG GGGTGAGTAC TCCCTCTGAA AAGCGGGCAT
 6661 GACTTCTGCG CTAAGATTGT CAGTTTCCAA AAACGAGGAG GATTTGATAT TCACCTGGCC
 6721 CGCGGTGATG CCTTTGAGGG TGGCCGCATC CATCTGGTCA GAAAAGACAA TCTTTTTGTT
 6781 GTCAAGCTTG GTGGCAAACG ACCCGTAGAG GGCGTTGGAC AGCAACTTGG CGATGGAGCG
 6841 CAGGGTTTGG TTTTTGTCGC GATCGGCGCG CTCCTTGGCC GCGATGTTTA GCTGCACGTA
 6901 TTCGCGCGCA ACGCACCGCC ATTCGGGAAA GACGGTGGTG CGCTCGTCGG GCACCAGGTG
 6961 CACGCGCCAA CCGCGGTTGT GCAGGGTGAC AAGGTCAACG CTGGTGGCTA CCTCTCCGCG
 7021 TAGGCGCTCG TTGGTCCAGC AGAGGCGGCC GCCCTTGCGC GAGCAGAATG GCGGTAGGGG
 7081 GTCTAGCTGC GTCTCGTCCG GGGGGTCTGC GTCCACGGTA AAGACCCCGG GCAGCAGGCG
 7141 CGCGTCGAAG TAGTCTATCT TGCATCCTTG CAAGTCTAGC GCCTGCTGCC ATGCGCGGGC
 7201 GGCAAGCGCG CGCTCGTATG GGTTGAGTGG GGGACCCCAT GGCATGGGGT GGGTGAGCGC
 7261 GGAGGCGTAC ATGCCGCAAA TGTCGTAAAC GTAGAGGGGC TCTCTGAGTA TTCCAAGATA
 7321 TGTAGGGTAG CATCTTCCAC CGCGGATGCT GGCGCGCACG TAATCGTATA GTTCGTGCGA
 7381 GGGAGCGAGG AGGTCGGGAC CGAGGTTGCT ACGGGCGGGC TGCTCTGCTC GGAAGACTAT
 7441 CTGCCTGAAG ATGGCATGTG AGTTGGATGA TATGGTTGGA CGCTGGAAGA CGTTGAAGCT
 7501 GGCGTCTGTG AGACCTACCG CGTCACGCAC GAAGGAGGCG TAGGAGTCGC GCAGCTTGTT
 7561 GACCAGCTCG GCGGTGACCT GCACGTCTAG GGCGCAGTAG TCCAGGGTTT CCTTGATGAT
 7621 GTCATACTTA TCCTGTCCCT TTTTTTTCCA CAGCTCGCGG TTGAGGACAA ACTCTTCGCG
 7681 GTCTTTCCAG TACTCTTGGA TCGGAAACCC GTCGGCCTCC GAACGGTAAG AGCCTAGCAT
 7741 GTAGAACTGG TTGACGGCCT GGTAGGCGCA GCATCCCTTT TCTACGGGTA GCGCGTATGC
 7801 CTGCGCGGCC TTCCGGAGCG AGGTGTGGGT GAGCGCAAAG GTGTCCCTGA CCATGACTTT
 7861 GAGGTACTGG TATTTGAAGT CAGTGTCGTC GCATCCGCCC TGCTCCCAGA GCAAAAAGTC
 7921 CGTGCGCTTT TTGGAACGCG GATTTGGCAG GGCGAAGGTG ACATCGTTGA AGAGTATCTT
 7981 TCCCGCGCGA GGCATAAAGT TGCGTGTGAT GCGGAAGGGT CCCGGCACCT CGGAACGGTT
 8041 GTTAATTACC TGGGCGGCGA GCACGATCTC GTCAAAGCCG TTGATGTTGT GGCCCACAAT
 8101 GTAAAGTTCC AAGAAGCGCG GGATGCCCTT GATGGAAGGC AATTTTTTAA GTTCCTCGTA
 8161 GGTGAGCTCT TCAGGGGAGC TGAGCCCGTG CTCTGAAAGG GCCCAGTCTG CAAGATGAGG
 8221 GTTGGAAGCG ACGAATGAGC TCCACAGGTC ACGGGCCATT AGCATTTGCA GGTGGTCGCG
 8281 AAAGGTCCTA AACTGGCGAC CTATGGCCAT TTTTTCTGGG GTGATGCAGT AGAAGGTAAG
 8341 CGGGTCTTGT TCCCAGCGGT CCCATCCAAG GTTCGCGGCT AGGTCTCGCG CGGCAGTCAC
 8401 TAGAGGCTCA TCTCCGCCGA ACTTCATGAC CAGCATGAAG GGCACGAGCT GCTTCCCAAA
 8461 GGCCCCCATC CAAGTATAGG TCTCTACATC GTAGGTGACA AAGAGACGCT CGGTGCGAGG
 8521 ATGCGAGCCG ATCGGGAAGA ACTGGATCTC CCGCCACCAA TTGGAGGAGT GGCTATTGAT
 8581 GTGGTGAAAG TAGAAGTCCC TGCGACGGGC CGAACACTCG TGCTGGCTTT TGTAAAAACG
 8641 TGCGCAGTAC TGGCAGCGGT GCACGGGCTG TACATCCTGC ACGAGGTTGA CCTGACGACC
 8701 GCGCACAAGG AAGCAGAGTG GGAATTTGAG CCCCTCGCCT GGCGGGTTTG GCTGGTGGTC
 8761 TTCTACTTCG GCTGCTTGTC CTTGACCGTC TGGCTGCTCG AGGGGAGTTA CGGTGGATCG
 8821 GACCACCACG CCGCGCGAGC CCAAAGTCCA GATGTCCGCG CGCGGCGGTC GGAGCTTGAT
 8881 GACAACATCG CGCAGATGGG AGCTGTCCAT GGTCTGGAGC TCCCGCGGCG TCAGGTCAGG
 8941 CGGGAGCTCC TGCAGGTTTA CCTCGCATAG ACGGGTCAGG GCGCGGGCTA GATCCAGGTG
 9001 ATACCTAATT TCCAGGGGCT GGTTGGTGGC GGCGTCGATG GCTTGCAAGA GGCCGCATCC
 9061 CCGCGGCGCG ACTACGGTAC CGCGCGGCGG GCGGTGGGCC GCGGGGGTGT CCTTGGATGA
 9121 TGCATCTAAA AGCGGTGACG CGGGCGAGCC CCCGGAGGTA GGGGGGGCTC CGGACCCGCC
 9181 GGGAGAGGGG GCAGGGGCAC GTCGGCGCCG CGCGCGGGCA GGAGCTGGTG CTGCGCGCGT
 9241 AGGTTGCTGG CGAACGCGAC GACGCGGCGG TTGATCTCCT GAATCTGGCG CCTCTGCGTG
 9301 AAGACGACGG GCCCGGTGAG CTTGAGCCTG AAAGAGAGTT CGACAGAATC AATTTCGGTG
 9361 TCGTTGACGG CGGCCTGGCG CAAAATCTCC TGCACGTCTC CTGAGTTGTC TTGATAGGCG
 9421 ATCTCGGCCA TGAACTGCTC GATCTCTTCC TCCTGGAGAT CTCCGCGTCC GGCTCGCTCC
 9481 ACGGTGGCGG CGAGGTCGTT GGAAATGCGG GCCATGAGCT GCGAGAAGGC GTTGAGGCCT
 9541 CCCTCGTTCC AGACGCGGCT GTAGACCACG CCCCCTTCGG CATCGCGGGC GCGCATGACC
 9601 ACCTGCGCGA GATTGAGCTC CACGTGCCGG GCGAAGACGG CGTAGTTTCG CAGGCGCTGA
 9661 AAGAGGTAGT TGAGGGTGGT GGCGGTGTGT TCTGCCACGA AGAAGTACAT AACCCAGCGT
 9721 CGCAACGTGG ATTCGTTGAT ATCCCCCAAG GCCTCAAGGC GCTCCATGGC CTCGTAGAAG
 9781 TCCACGGCGA AGTTGAAAAA CTGGGAGTTG CGCGCCGACA CGGTTAACTC CTCCTCCAGA
 9841 AGACGGATGA GCTCGGCGAC AGTGTCGCGC ACCTCGCGCT CAAAGGCTAC AGGGGCCTCT
 9901 TCTTCTTCTT CAATCTCCTC TTCCATAAGG GCCTCCCCTT CTTCTTCTTC TGGCGGCGGT
 9961 GGGGGAGGGG GGACACGGCG GCGACGACGG CGCACCGGGA GGCGGTCGAC AAAGCGCTCG
10021 ATCATCTCCC CGCGGCGACG GCGCATGGTC TCGGTGACGG CGCGGCCGTT CTCGCGGGGG
10081 CGCAGTTGGA AGACGCCGCC CGTCATGTCC CGGTTATGGG TTGGCGGGGG GCTGCCATGC
10141 GGCAGGGATA CGGCGCTAAC GATGCATCTC AACAATTGTT GTGTAGGTAC TCCGCCGCCG
10201 AGGGACCTGA GCGAGTCCGC ATCGACCGGA TCGGAAAACC TCTCGAGAAA GGCGTCTAAC
10261 CAGTCACAGT CGCAAGGTAG GCTGAGCACC GTGGCGGGCG GCAGCGGGCG GCGGTCGGGG
10321 TTGTTTCTGG CGGAGGTGCT GCTGATGATG TAATTAAAGT AGGCGGTCTT GAGACGGCGG
10381 ATGGTCGACA GAAGCACCAT GTCCTTGGGT CCGGCCTGCT GAATGCGCAG GCGGTCGGCC
10441 ATGCCCCAGG CTTCGTTTTG ACATCGGCGC AGGTCTTTGT AGTAGTCTTG CATGAGCCTT
10501 TCTACCGGCA CTTCTTCTTC TCCTTCCTCT TGTCCTGCAT CTCTTGCATC TATCGCTGCG
10561 GCGGCGGCGG AGTTTGGCCG TAGGTGGCGC CCTCTTCCTC CCATGCGTGT GACCCCGAAG
10621 CCCCTCATCG GCTGAAGCAG GGCTAGGTCG GCGACAACGC GCTCGGCTAA TATGGCCTGC
10681 TGCACCTGCG TGAGGGTAGA CTGGAAGTCA TCCATGTCCA CAAAGCGGTG GTATGCGCCC
10741 GTGTTGATGG TGTAAGTGCA GTTGGCCATA ACGGACCAGT TAACGGTCTG GTGACCCGGC
10801 TGCGAGAGCT CGGTGTACCT GAGACGCGAG TAAGCCCTCG AGTCAAATAC GTAGTCGTTG
10861 CAAGTCCGCA CCAGGTACTG GTATCCCACC AAAAAGTGCG GCGGCGGCTG GCGGTAGAGG
10921 GGCCAGCGTA GGGTGGCCGG GGCTCCGGGG GCGAGATCTT CCAACATAAG GCGATGATAT
10981 CCGTAGATGT ACCTGGACAT CCAGGTGATG CCGGCGGCGG TGGTGGAGGC GCGCGGAAAG
11041 TCGCGGACGC GGTTCCAGAT GTTGCGCAGC GGCAAAAAGT GCTCCATGGT CGGGACGCTC
11101 TGGCCGGTCA GGCGCGCGCA ATCGTTGACG CTCTAGACCG TGCAAAAGGA GAGCCTGTAA
11161 GCGGGCACTC TTCCGTGGTC TGGTGGATAA ATTCGCAAGG GTATCATGGC GGACGACCGG
11221 GGTTCGAGCC CCGTATCCGG CCGTCCGCCG TGATCCATGC GGTTACCGCC CGCGTGTCGA
11281 ACCCAGGTGT GCGACGTCAG ACAACGGGGG AGTGCTCCTT TTGGCTTCCT TCCAGGCGCG
11341 GCGGCTGCTG CGCTAGCTTT TTTGGCCACT GGCCGCGCGC AGCGTAAGCG GTTAGGCTGG
11401 AAAGCGAAAG CATTAAGTGG CTCGCTCCCT GTAGCCGGAG GGTTATTTTC CAAGGGTTGA
11461 GTCGCGGGAC CCCCGGTTCG AGTCTCGGAC CGGCCGGACT GCGGCGAACG GGGGTTTGCC
11521 TCCCCGTCAT GCAAGACCCC GCTTGCAAAT TCCTCCGGAA ACAGGGACGA GCCCCTTTTT
11581 TGCTTTTCCC AGATGCATCC GGTGCTGCGG CAGATGCGCC CCCCTCCTCA GCAGCGGCAA
11641 GAGCAAGAGC AGCGGCAGAC ATGCAGGGCA CCCTCCCCTC CTCCTACCGC GTCAGGAGGG
11701 GCGACATCCG CGGTTGACGC GGCAGCAGAT GGTGATTACG AACCCCCGCG GCGCCGGGCC
11761 CGGCACTACC TGGACTTGGA GGAGGGCGAG GGCCTGGCGC GGCTAGGAGC GCCCTCTCCT
11821 GAGCGGTACC CAAGGGTGCA GCTGAAGCGT GATACGCGTG AGGCGTACGT GCCGCGGCAG
11881 AACCTGTTTC GCGACCGCGA GGGAGAGGAG CCCGAGGAGA TGCGGGATCG AAAGTTCCAC
11941 GCAGGGCGCG AGCTGCGGCA TGGCCTGAAT CGCGAGCGGT TGCTGCGCGA GGAGGACTTT
12001 GAGCCCGACG CGCGAACCGG GATTAGTCCC GCGCGCGCAC ACGTGGCGGC CGCCGACCTG
12061 GTAACCGCAT ACGAGCAGAC GGTGAACCAG GAGATTAACT TTCAAAAAAG CTTTAACAAC
12121 CACGTGCGTA CGCTTGTGGC GCGCGAGGAG GTGGCTATAG GACTGATGCA TCTGTGGGAC
12181 TTTGTAAGCG CGCTGGAGCA AAACCCAAAT AGCAAGCCGC TCATGGCGCA GCTGTTCCTT
12241 ATAGTGCAGC ACAGCAGGGA CAACGAGGCA TTCAGGGATG CGCTGCTAAA CATAGTAGAG
12301 CCCGAGGGCC GCTGGCTGCT CGATTTGATA AACATCCTGC AGAGCATAGT GGTGCAGGAG
12361 CGCAGCTTGA GCCTGGCTGA CAAGGTGGCC GCCATCAACT ATTCCATGCT TAGCCTGGGC
12421 AAGTTTTACG CCCGCAAGAT ATACCATACC CCTTACGTTC CCATAGACAA GGAGGTAAAG
12481 ATCGAGGGGT TCTACATGCG CATGGCGCTG AAGGTGCTTA CCTTGAGCGA CGACCTGGGC
12541 GTTTATCGCA ACGAGCGCAT CCACAAGGCC GTGAGCGTGA GCCGGCGGCG CGAGCTCAGC
12601 GACCGCGAGC TGATGCACAG CCTGCAAAGG GCCCTGGCTG GCACGGGCAG CGGCGATAGA
12661 GAGGCCGAGT CCTACTTTGA CGCGGGCGCT GACCTGCGCT GGGCCCCAAG CCGACGCGCC
12721 CTGGAGGCAG CTGGGGCCGG ACCTGGGCTG GCGGTGGCAC CCGCGCGCGC TGGCAACGTC
12781 GGCGGCGTGG AGGAATATGA CGAGGACGAT GAGTACGAGC CAGAGGACGG CGAGTACTAA
12841 GCGGTGATGT TTCTGATCAG ATGATGCAAG ACGCAACGGA CCCGGCGGTG CGGGCGGCGC
12901 TGCAGAGCCA GCCGTCCGGC CTTAACTCCA CGGACGACTG GCGCCAGGTC ATGGACCGCA
12961 TCATGTCGCT GACTGCGCGC AATCCTGACG CGTTCCGGCA GCAGCCGCAG GCCAACCGGC
13021 TCTCCGCAAT TCTGGAAGCG GTGGTCCCGG CGCGCGCAAA CCCCACGCAC GAGAAGGTGC
13081 TGGCGATCGT AAACGCGCTG GCCGAAAACA GGGCCATCCG GCCCGACGAG GCCGGCCTGG
13141 TCTACGACGC GCTGCTTCAG CGCGTGGCTC GTTACAACAG CGGCAACGTG CAGACCAACC
13201 TGGACCGGCT GGTGGGGGAT GTGCGCGAGG CCGTGGCGCA GCGTGAGCGC GCGCAGCAGC
13261 AGGGCAACCT GGGCTCCATG GTTGCACTAA ACGCCTTCCT GAGTACACAG CCCGCCAACG
13321 TGCCGCGGGG ACAGGAGGAC TACACCAACT TTGTGAGCGC ACTGCGGCTA ATGGTGACTG
13381 AGACACCGCA AAGTGAGGTG TACCAGTCTG GGCCAGACTA TTTTTTCCAG ACCAGTAGAC
13441 AAGGCCTGCA GACCGTAAAC CTGAGCCAGG CTTTCAAAAA CTTGCAGGGG CTGTGGGGGG
13501 TGCGGGCTCC CACAGGCGAC CGCGCGACCG TGTCTAGCTT GCTGACGCCC AACTCGCGCC
13561 TGTTGCTGCT GCTAATAGCG CCCTTCACGG ACAGTGGCAG CGTGTCCCGG GACACATACC
13621 TAGGTCACTT GCTGACACTG TACCGCGAGG CCATAGGTCA GGCGCATGTG GACGAGCATA
13681 CTTTCCAGGA GATTACAAGT GTCAGCCGCG CGCTGGGGCA GGAGGACACG GGCAGCCTGG
13741 AGGCAACCCT AAACTACCTG CTGACCAACC GGCGGCAGAA GATCCCCTCG TTGCACAGTT
13801 TAAACAGCGA GGAGGAGCGC ATTTTGCGCT ACGTGCAGCA GAGCGTGAGC CTTAACCTGA
13861 TGCGCGACGG GGTAACGCCC AGCGTGGCGC TGGACATGAC CGCGCGCAAC ATGGAACCGG
13921 GCATGTATGC CTCAAACCGG CCGTTTATCA ACCGCCTAAT GGACTACTTG CATCGCGCGG
13981 CCGCCGTGAA CCCCGAGTAT TTCACCAATG CCATCTTGAA CCCGCACTGG CTACCGCCCC
14041 CTGGTTTCTA CACCGGGGGA TTCGAGGTGC CCGAGGGTAA CGATGGATTC CTCTGGGACG
14101 ACATAGACGA CAGCGTGTTT TCCCCGCAAC CGCAGACCCT GCTAGAGTTG CAACAGCGCG
14161 AGCAGGCAGA GGCGGCGCTG CGAAAGGAAA GCTTCCGCAG GCCAAGCAGC TTGTCCGATC
14221 TAGGCGCTGC GGCCCCGCGG TCAGATGCTA GTAGCCCATT TCCAAGCTTG ATAGGGTCTC
14281 TTACCAGCAC TCGCACCACC CGCCCGCGCC TGCTGGGCGA GGAGGAGTAC CTAAACAACT
14341 CGCTGCTGCA GCCGCAGCGC GAAAAAAACC TGCCTCCGGC ATTTCCCAAC AACGGGATAG
14401 AGAGCCTAGT GGACAAGATG AGTAGATGGA AGACGTACGC GCAGGAGCAC AGGGACGTGC
14461 CAGGCCCGCG CCCGCCCACC CGTCGTCAAA GGCACGACCG TCAGCGGGGT CTGGTGTGGG
14521 AGGACGATGA CTCGGCAGAC GACAGCAGCG TCCTGGATTT GGGAGGGAGT GGCAACCCGT
14581 TTGCGCACCT TCGCCCCAGG CTGGGGAGAA TGTTTTAAAA AAAAAAAAGC ATGATGCAAA
14641 ATAAAAAACT CACCAAGGCC ATGGCACCGA GCGTTGGTTT TCTTGTATTC CCCTTAGTAT
14701 GCGGCGCGCG GCGATGTATG AGGAAGGTCC TCCTCCCTCC TACGAGAGTG TGGTGAGCGC
14761 GGCGCCAGTG GCGGCGGCGC TGGGTTCTCC CTTCGATGCT CCCCTGGACC CGCCGTTTGT
14821 GCCTCCGCGG TACCTGCGGC CTACCGGGGG GAGAAACAGC ATCCGTTACT CTGAGTTGGC
14881 ACCCCTATTC GACACCACCC GTGTGTACCT GGTGGACAAC AAGTCAACGG ATGTGGCATC
14941 CCTGAACTAC CAGAACGACC ACAGCAACTT TCTGACCACG GTCATTCAAA ACAATGACTA
15001 CAGCCCGGGG GAGGCAAGCA CACAGACCAT CAATCTTGAC GACCGGTCGC ACTGGGGCGG
15061 CGACCTGAAA ACCATCCTGC ATACCAACAT GCCAAATGTG AACGAGTTCA TGTTTACCAA
15121 TAAGTTTAAG GCGCGGGTGA TGGTGTCGCG CTTGCCTACT AAGGACAATC AGGTGGAGCT
15181 GAAATACGAG TGGGTGGAGT TCACGCTGCC CGAGGGCAAC TACTCCGAGA CCATGACCAT
15241 AGACCTTATG AACAACGCGA TCGTGGAGCA CTACTTGAAA GTGGGCAGAC AGAACGGGGT
15301 TCTGGAAAGC GACATCGGGG TAAAGTTTGA CACCCGCAAC TTCAGACTGG GGTTTGACCC
15361 CGTCACTGGT CTTGTCATGC CTGGGGTATA TACAAACGAA GCCTTCCATC CAGACATCAT
15421 TTTGCTGCCA GGATGCGGGG TGGACTTCAC CCACAGCCGC CTGAGCAACT TGTTGGGCAT
15481 CCGCAAGCGG CAACCCTTCC AGGAGGGCTT TAGGATCACC TACGATGATC TGGAGGGTGG
15541 TAACATTCCC GCACTGTTGG ATGTGGACGC CTACCAGGCG AGCTTGAAAG ATGACACCGA
15601 ACAGGGCGGG GGTGGCGCAG GCGGCAGCAA CAGCAGTGGC AGCGGCGCGG AAGAGAACTC
15661 CAACGCGGCA GCCGCGGCAA TGCAGCCGGT GGAGGACATG AACGATCATG CCATTCGCGG
15721 CGACACCTTT GCCACACGGG CTGAGGAGAA GCGCGCTGAG GCCGAAGCAG CGGCCGAAGC
15781 TGCCGCCCCC GCTGCGCAAC CCGAGGTCGA GAAGCCTCAG AAGAAACCGG TGATCAAACC
15841 CCTGACAGAG GACAGCAAGA AACGCAGTTA CAACCTAATA AGCAATGACA GCACCTTCAC
15901 CCAGTACCGC AGCTGGTACC TTGCATACAA CTACGGCGAC CCTCAGACCG GAATCCGCTC
15961 ATGGACCCTG CTTTGCACTC CTGACGTAAC CTGCGGCTCG GAGCAGGTCT ACTGGTCGTT
16021 GCCAGACATG ATGCAAGACC CCGTGACCTT CCGCTCCACG CGCCAGATCA GCAACTTTCC
16081 GGTGGTGGGC GCCGAGCTGT TGCCCGTGCA CTCCAAGAGC TTCTACAACG ACCAGGCCGT
16141 CTACTCCCAA CTCATCCGCC AGTTTACCTC TCTGACCCAC GTGTTCAATC GCTTTCCCGA
16201 GAACCAGATT TTGGCGCGCC CGCCAGCCCC CACCATCACC ACCGTCAGTG AAAACGTTCC
16261 TGCTCTCACA GATCACGGGA CGCTACCGCT GCGCAACAGC ATCGGAGGAG TCCAGCGAGT
16321 GACCATTACT GACGCCAGAC GCCGCACCTG CCCCTACGTT TACAAGGCCC TGGGCATAGT
16381 CTCGCCGCGC GTCCTATCGA GCCGCACTTT TTGAGCAAGC ATGTCCATCC TTATATCGCC
16441 CAGCAATAAC ACAGGCTGGG GCCTGCGCTT CCCAAGCAAG ATGTTTGGCG GGGCCAAGAA
16501 GCGCTCCGAC CAACACCCAG TGCGCGTGCG CGGGCACTAC CGCGCGCCCT GGGGCGCGCA
16561 CAAACGCGGC CGCACTGGGC GCACCACCGT CGATGACGCC ATCGACGCGG TGGTGGAGGA
16621 GGCGCGCAAC TACACGCCCA CGCCGCCACC AGTGTCCACA GTGGACGCGG CCATTCAGAC
16681 CGTGGTGCGC GGAGCCCGGC GCTATGCTAA AATGAAGAGA CGGCGGAGGC GCGTAGCACG
16741 TCGCCACCGC CGCCGACCCG GCACTGCCGC CCAACGCGCG GCGGCGGCCC TGCTTAACCG
16801 CGCACGTCGC ACCGGCCGAC GGGCGGCCAT GCGGGCCGCT CGAAGGCTGG CCGCGGGTAT
16861 TGTCACTGTG CCCCCCAGGT CCAGGCGACG AGCGGCCGCC GCAGCAGCCG CGGCCATTAG
16921 TGCTATGACT CAGGGTCGCA GGGGCAACGT GTATTGGGTG CGCGACTCGG TTAGCGGCCT
16981 GCGCGTGCCC GTGCGCACCC GCCCCCCGCG CAACTAGATT GCAAGAAAAA ACTACTTAGA
17041 CTCGTACTGT TGTATGTATC CAGCGGCGGC GGCGCGCAAC GAAGCTATGT CCAAGCGCAA
17101 AATCAAAGAA GAGATGCTCC AGGTCATCGC GCCGGAGATC TATGGCCCCC CGAAGAAGGA
17161 AGAGCAGGAT TACAAGCCCC GAAAGCTAAA GCGGGTCAAA AAGAAAAAGA AAGATGATGA
17221 TGATGAACTT GACGACGAGG TGGAACTGCT GCACGCTACC GCGCCCAGGC GACGGGTACA
17281 GTGGAAAGGT CGACGCGTAA AACGTGTTTT GCGACCCGGC ACCACCGTAG TCTTTACGCC
17341 CGGTGAGCGC TCCACCCGCA CCTACAAGCG CGTGTATGAT GAGGTGTACG GCGACGAGGA
17401 CCTGCTTGAG CAGGCCAACG AGCGCCTCGG GGAGTTTGCC TACGGAAAGC GGCATAAGGA
17461 CATGCTGGCG TTGCCGCTGG ACGAGGGCAA CCCAACACCT AGCCTAAAGC CCGTAACACT
17521 GCAGCAGGTG CTGCCCGCGC TTGCACCGTC CGAAGAAAAG CGCGGCCTAA AGCGCGAGTC
17581 TGGTGACTTG GCACCCACCG TGCAGCTGAT GGTACCCAAG CGCCAGCGAC TGGAAGATGT
17641 CTTGGAAAAA ATGACCGTGG AACCTGGGCT GGAGCCCGAG GTCCGCGTGC GGCCAATCAA
17701 GCAGGTGGCG CCGGGACTGG GCGTGCAGAC CGTGGACGTT CAGATACCCA CTACCAGTAG
17761 CACCAGTATT GCCACCGCCA CAGAGGGCAT GGAGACACAA ACGTCCCCGG TTGCCTCAGC
17821 GGTGGCGGAT GCCGCGGTGC AGGCGGTCGC TGCGGCCGCG TCCAAGACCT CTACGGAGGT
17881 GCAAACGGAC CCGTGGATGT TTCGCGTTTC AGCCCCCCGG CGCCCGCGCG GTTCGAGGAA
17941 GTACGGCGCC GCCAGCGCGC TACTGCCCGA ATATGCCCTA CATCCTTCCA TTGCGCCTAC
18001 CCCCGGCTAT CGTGGCTACA CCTACCGCCC CAGAAGACGA GCAACTACCC GACGCCGAAC
18061 CACCACTGGA ACCCGCCGCC GCCGTCGCCG TCGCCAGCCC GTGCTGGCCC CGATTTCCGT
18121 GCGCAGGGTG GCTCGCGAAG GAGGCAGGAC CCTGGTGCTG CCAACAGCGC GCTACCACCC
18181 CAGCATCGTT TAAAAGCCGG TCTTTGTGGT TCTTGCAGAT ATGGCCCTCA CCTGCCGCCT
18241 CCGTTTCCCG GTGCCGGGAT TCCGAGGAAG AATGCACCGT AGGAGGGGCA TGGCCGGCCA
18301 CGGCCTGACG GGCGGCATGC GTCGTGCGCA CCACCGGCGG CGGCGCGCGT CGCACCGTCG
18361 CATGCGCGGC GGTATCCTGC CCCTCCTTAT TCCACTGATC GCCGCGGCGA TTGGCGCCGT
18421 GCCCGGAATT GCATCCGTGG CCTTGCAGGC GCAGAGACAC TGATTAAAAA CAAGTTGCAT
18481 GTGGAAAAAT CAAAATAAAA AGTCTGGACT CTCACGCTCG CTTGGTCCTG TAACTATTTT
18541 GTAGAATGGA AGACATCAAC TTTGCGTCTC TGGCCCCGCG ACACGGCTCG CGCCCGTTCA
18601 TGGGAAACTG GCAAGATATC GGCACCAGCA ATATGAGCGG TGGCGCCTTC AGCTGGGGCT
18661 CGCTGTGGAG CGGCATTAAA AATTTCGGTT CCACCGTTAA GAACTATGGC AGCAAGGCCT
18721 GGAACAGCAG CACAGGCCAG ATGCTGAGGG ATAAGTTGAA AGAGCAAAAT TTCCAACAAA
18781 AGGTGGTAGA TGGCCTGGCC TCTGGCATTA GCGGGGTGGT GGACCTGGCC AACCAGGCAG
18841 TGCAAAATAA GATTAACAGT AAGCTTGATC CCCGCCCTCC CGTAGAGGAG CCTCCACCGG
18901 CCGTGGAGAC AGTGTCTCCA GAGGGGCGTG GCGAAAAGCG TCCGCGCCCC GACAGGGAAG
18961 AAACTCTGGT GACGCAAATA GACGAGCCTC CCTCGTACGA GGAGGCACTA AAGCAAGGCC
19021 TGCCCACCAC CCGTCCCATC GCGCCCATGG CTACCGGAGT GCTGGGCCAG CACACACCCG
19081 TAACGCTGGA CCTGCCTCCC CCCGCCGACA CCCAGCAGAA ACCTGTGCTG CCAGGCCCGA
19141 CCGCCGTTGT TGTAACCCGT CCTAGCCGCG CGTCCCTGCG CCGCGCCGCC AGCGGTCCGC
19201 GATCGTTGCG GCCCGTAGCC AGTGGCAACT GGCAAAGCAC ACTGAACAGC ATCGTGGGTC
19261 TGGGGGTGCA ATCCCTGAAG CGCCGACGAT GCTTCTGAAT AGCTAACGTG TCGTATGTGT
19321 GTCATGTATG CGTCCATGTC GCCGCCAGAG GAGCTGCTGA GCCGCCGCGC GCCCGCTTTC
19381 CAAGATGGCT ACCCCTTCGA TGATGCCGCA GTGGTCTTAC ATGCACATCT CGGGCCAGGA
19441 CGCCTCGGAG TACCTGAGCC CCGGGCTGGT GCAGTTTGCC CGCGCCACCG AGACGTACTT
19501 CAGCCTGAAT AACAAGTTTA GAAACCCCAC GGTGGCGCCT ACGCACGACG TGACCACAGA
19561 CCGGTCCCAG CGTTTGACGC TGCGGTTCAT CCCTGTGGAC CGTGAGGATA CTGCGTACTC
19621 GTACAAGGCG CGGTTCACCC TAGCTGTGGG TGATAACCGT GTGCTGGACA TGGCTTCCAC
19681 GTACTTTGAC ATCCGCGGCG TGCTGGACAG GGGCCCTACT TTTAAGCCCT ACTCTGGCAC
19741 TGCCTACAAC GCCCTGGCTC CCAAGGGTGC CCCAAATCCT TGCGAATGGG ATGAAGCTGC
19801 TACTGCTCTT GAAATAAACC TAGAAGAAGA GGACGATGAC AACGAAGACG AAGTAGACGA
19861 GCAAGCTGAG CAGCAAAAAA CTCACGTATT TGGGCAGGCG CCTTATTCTG GTATAAATAT
19921 TACAAAGGAG GGTATTCAAA TAGGTGTCGA AGGTCAAACA CCTAAATATG CCGATAAAAC
19981 ATTTCAACCT GAACCTCAAA TAGGAGAATC TCAGTGGTAC GAAACTGAAA TTAATCATGC
20041 AGCTGGGAGA GTCCTTAAAA AGACTACCCC AATGAAACCA TGTTACGGTT CATATGCAAA
20101 ACCCACAAAT GAAAATGGAG GGCAAGGCAT TCTTGTAAAG CAACAAAATG GAAAGCTAGA
20161 AAGTCAAGTG GAAATGCAAT TTTTCTCAAC TACTGAGGCG ACCGCAGGCA ATGGTGATAA
20221 CTTGACTCCT AAAGTGGTAT TGTACAGTGA AGATGTAGAT ATAGAAACCC CAGACACTCA
20281 TATTTCTTAC ATGCCCACTA TTAAGGAAGG TAACTCACGA GAACTAATGG GCCAACAATC
20341 TATGCCCAAC AGGCCTAATT ACATTGCTTT TAGGGACAAT TTTATTGGTC TAATGTATTA
20401 CAACAGCACG GGTAATATGG GTGTTCTGGC GGGCCAAGCA TCGCAGTTGA ATGCTGTTGT
20461 AGATTTGCAA GACAGAAACA CAGAGCTTTC ATACCAGCTT TTGCTTGATT CCATTGGTGA
20521 TAGAACCAGG TACTTTTCTA TGTGGAATCA GGCTGTTGAC AGCTATGATC CAGATGTTAG
20581 AATTATTGAA AATCATGGAA CTGAAGATGA ACTTCCAAAT TACTGCTTTC CACTGGGAGG
20641 TGTGATTAAT ACAGAGACTC TTACCAAGGT AAAACCTAAA ACAGGTCAGG AAAATGGATG
20701 GGAAAAAGAT GCTACAGAAT TTTCAGATAA AAATGAAATA AGAGTTGGAA ATAATTTTGC
20761 CATGGAAATC AATCTAAATG CCAACCTGTG GAGAAATTTC CTGTACTCCA ACATAGCGCT
20821 GTATTTGCCC GACAAGCTAA AGTACAGTCC TTCCAACGTA AAAATTTCTG ATAACCCAAA
20881 CACCTACGAC TACATGAACA AGCGAGTGGT GGCTCCCGGG TTAGTGGACT GCTACATTAA
20941 CCTTGGAGCA CGCTGGTCCC TTGACTATAT GGACAACGTC AACCCATTTA ACCACCACCG
21001 CAATGCTGGC CTGCGCTACC GCTCAATGTT GCTGGGCAAT GGTCGCTATG TGCCCTTCCA
21061 CATCCAGGTG CCTCAGAAGT TCTTTGCCAT TAAAAACCTC CTTCTCCTGC CGGGCTCATA
21121 CACCTACGAG TGGAACTTCA GGAAGGATGT TAACATGGTT CTGCAGAGCT CCCTAGGAAA
21181 TGACCTAAGG GTTGACGGAG CCAGCATTAA GTTTGATAGC ATTTGCCTTT ACGCCACCTT
21241 CTTCCCCATG GCCCACAACA CCGCCTCCAC GCTTGAGGCC ATGCTTAGAA ACGACACCAA
21301 CGACCAGTCC TTTAACGACT ATCTCTCCGC CGCCAACATG CTCTACCCTA TACCCGCCAA
21361 CGCTACCAAC GTGCCCATAT CCATCCCCTC CCGCAACTGG GCGGCTTTCC GCGGCTGGGC
21421 CTTCACGCGC CTTAAGACTA AGGAAACCCC ATCACTGGGC TCGGGCTACG ACCCTTATTA
21481 CACCTACTCT GGCTCTATAC CCTACCTAGA TGGAACCTTT TACCTCAACC ACACCTTTAA
21541 GAAGGTGGCC ATTACCTTTG ACTCTTCTGT CAGCTGGCCT GGCAATGACC GCCTGCTTAC
21601 CCCCAACGAG TTTGAAATTA AGCGCTCAGT TGACGGGGAG GGTTACAACG TTGCCCAGTG
21661 TAACATGACC AAAGACTGGT TCCTGGTACA AATGCTAGCT AACTACAACA TTGGCTACCA
21721 GGGCTTCTAT ATCCCAGAGA GCTACAAGGA CCGCATGTAC TCCTTCTTTA GAAACTTCCA
21781 GCCCATGAGC CGTCAGGTGG TGGATGATAC TAAATACAAG GACTACCAAC AGGTGGGCAT
21841 CCTACACCAA CACAACAACT CTGGATTTGT TGGCTACCTT GCCCCCACCA TGCGCGAAGG
21901 ACAGGCCTAC CCTGCTAACT TCCCCTATCC GCTTATAGGC AAGACCGCAG TTGACAGCAT
21961 TACCCAGAAA AAGTTTCTTT GCGATCGCAC CCTTTGGCGC ATCCCATTCT CCAGTAACTT
22021 TATGTCCATG GGCGCACTCA CAGACCTGGG CCAAAACCTT CTCTACGCCA ACTCCGCCCA
22081 CGCGCTAGAC ATGACTTTTG AGGTGGATCC CATGGACGAG CCCACCCTTC TTTATGTTTT
22141 GTTTGAAGTC TTTGACGTGG TCCGTGTGCA CCGGCCGCAC CGCGGCGTCA TCGAAACCGT
22201 GTACCTGCGC ACGCCCTTCT CGGCCGGCAA CGCCACAACA TAAAGAAGCA AGCAACATCA
22261 ACAACAGCTG CCGCCATGGG CTCCAGTGAG CAGGAACTGA AAGCCATTGT CAAAGATCTT
22321 GGTTGTGGGC CATATTTTTT GGGCACCTAT GACAAGCGCT TTCCAGGCTT TGTTTCTCCA
22381 CACAAGCTCG CCTGCGCCAT AGTCAATACG GCCGGTCGCG AGACTGGGGG CGTACACTGG
22441 ATGGCCTTTG CCTGGAACCC GCACTCAAAA ACATGCTACC TCTTTGAGCC CTTTGGCTTT
22501 TCTGACCAGC GACTCAAGCA GGTTTACCAG TTTGAGTACG AGTCACTCCT GCGCCGTAGC
22561 GCCATTGCTT CTTCCCCCGA CCGCTGTATA ACGCTGGAAA AGTCCACCCA AAGCGTACAG
22621 GGGCCCAACT CGGCCGCCTG TGGACTATTC TGCTGCATGT TTCTCCACGC CTTTGCCAAC
22681 TGGCCCCAAA CTCCCATGGA TCACAACCCC ACCATGAACC TTATTACCGG GGTACCCAAC
22741 TCCATGCTCA ACAGTCCCCA GGTACAGCCC ACCCTGCGTC GCAACCAGGA ACAGCTCTAC
22801 AGCTTCCTGG AGCGCCACTC GCCCTACTTC CGCAGCCACA GTGCGCAGAT TAGGAGCGCC
22861 ACTTCTTTTT GTCACTTGAA AAACATGTAA AAATAATGTA CTAGAGACAC TTTCAATAAA
22921 GGCAAATGCT TTTATTTGTA CACTCTCGGG TGATTATTTA CCCCCACCCT TGCCGTCTGC
22981 GCCGTTTAAA AATCAAAGGG GTTCTGCCGC GCATCGCTAT GCGCCACTGG CAGGGACACG
23041 TTGCGATACT GGTGTTTAGT GCTCCACTTA AACTCAGGCA CAACCATCCG CGGCAGCTCG
23101 GTGAAGTTTT CACTCCACAG GCTGCGCACC ATCACCAACG CGTTTAGCAG GTCGGGCGCC
23161 GATATCTTGA AGTCGCAGTT GGGGCCTCCG CCCTGCGCGC GCGAGTTGCG ATACACAGGG
23221 TTGCAGCACT GGAACACTAT CAGCGCCGGG TGGTGCACGC TGGCCAGCAC GCTCTTGTCG
23281 GAGATCAGAT CCGCGTCCAG GTCCTCCGCG TTGCTCAGGG CGAACGGAGT CAACTTTGGT
23341 AGCTGCCTTC CCAAAAAGGG CGCGTGCCCA GGCTTTGAGT TGCACTCGCA CCGTAGTGGC
23401 ATCAAAAGGT GACCGTGCCC GGTCTGGGCG TTAGGATACA GCGCCTGCAT AAAAGCCTTG
23461 ATCTGCTTAA AAGCCACCTG AGCCTTTGCG CCTTCAGAGA AGAACATGCC GCAAGACTTG
23521 CCGGAAAACT GATTGGCCGG ACAGGCCGCG TCGTGCACGC AGCACCTTGC GTCGGTGTTG
23581 GAGATCTGCA CCACATTTCG GCCCCACCGG TTCTTCACGA TCTTGGCCTT GCTAGACTGC
23641 TCCTTCAGCG CGCGCTGCCC GTTTTCGCTC GTCACATCCA TTTCAATCAC GTGCTCCTTA
23701 TTTATCATAA TGCTTCCGTG TAGACACTTA AGCTCGCCTT CGATCTCAGC GCAGCGGTGC
23761 AGCCACAACG CGCAGCCCGT GGGCTCGTGA TGCTTGTAGG TCACCTCTGC AAACGACTGC
23821 AGGTACGCCT GCAGGAATCG CCCCATCATC GTCACAAAGG TCTTGTTGCT GGTGAAGGTC
23881 AGCTGCAACC CGCGGTGCTC CTCGTTCAGC CAGGTCTTGC ATACGGCCGC CAGAGCTTCC
23941 ACTTGGTCAG GCAGTAGTTT GAAGTTCGCC TTTAGATCGT TATCCACGTG GTACTTGTCC
24001 ATCAGCGCGC GCGCAGCCTC CATGCCCTTC TCCCACGCAG ACACGATCGG CACACTCAGC
24061 GGGTTCATCA CCGTAATTTC ACTTTCCGCT TCGCTGGGCT CTTCCTCTTC CTCTTGCGTC
24121 CGCATACCAC GCGCCACTGG GTCGTCTTCA TTCAGCCGCC GCACTGTGCG CTTACCTCCT
24181 TTGCCATGCT TGATTAGCAC CGGTGGGTTG CTGAAACCCA CCATTTGTAG CGCCACATCT
24241 TCTCTTTCTT CCTCGCTGTC CACGATTACC TCTGGTGATG GCGGGCGCTC GGGCTTGGGA
24301 GAAGGGCGCT TCTTTTTCTT CTTGGGCGCA ATGGCCAAAT CCGCCGCCGA GGTCGATGGC
24361 CGCGGGCTGG GTGTGCGCGG CACCAGCGCG TCTTGTGATG AGTCTTCCTC GTCCTCGGAC
24421 TCGATACGCC GCCTCATCCG CTTTTTTGGG GGCGCCCGGG GAGGCGGCGG CGACGGGGAC
24481 GGGGACGACA CGTCCTCCAT GGTTGGGGGA CGTCGCGCCG CACCGCGTCC GCGCTCGGGG
24541 GTGGTTTCGC GCTGCTCCTC TTCCCGACTG GCCATTTCCT TCTCCTATAG GCAGAAAAAG
24601 ATCATGGAGT CAGTCGAGAA GAAGGACAGC CTAACCGCCC CCTCTGAGTT CGCCACCACC
24661 GCCTCCACCG ATGCCGCCAA CGCGCCTACC ACCTTCCCCG TCGAGGCACC CCCGCTTGAG
24721 GAGGAGGAAG TGATTATCGA GCAGGACCCA GGTTTTGTAA GCGAAGACGA CGAGGACCGC
24781 TCAGTACCAA CAGAGGATAA AAAGCAAGAC CAGGACAACG CAGAGGCAAA CGAGGAACAA
24841 GTCGGGCGGG GGGACGAAAG GCATGGCGAC TACCTAGATG TGGGAGACGA CGTGCTGTTG
24901 AAGCATCTGC AGCGCCAGTG CGCCATTATC TGCGACGCGT TGCAAGAGCG CAGCGATGTG
24961 CCCCTCGCCA TAGCGGATGT CAGCCTTGCC TACGAACGCC ACCTATTCTC ACCGCGCGTA
25021 CCCCCCAAAC GCCAAGAAAA CGGCACATGC GAGCCCAACC CGCGCCTCAA CTTCTACCCC
25081 GTATTTGCCG TGCCAGAGGT GCTTGCCACC TATCACATCT TTTTCCAAAA CTGCAAGATA
25141 CCCCTATCCT GCCGTGCCAA CCGCAGCCGA GCGGACAAGC AGCTGGCCTT GCGGCAGGGC
25201 GCTGTCATAC CTGATATCGC CTCGCTCAAC GAAGTGCCAA AAATCTTTGA GGGTCTTGGA
25261 CGCGACGAGA AGCGCGCGGC AAACGCTCTG CAACAGGAAA ACAGCGAAAA TGAAAGTCAC
25321 TCTGGAGTGT TGGTGGAACT CGAGGGTGAC AACGCGCGCC TAGCCGTACT AAAACGCAGC
25381 ATCGAGGTCA CCCACTTTGC CTACCCGGCA CTTAACCTAC CCCCCAAGGT CATGAGCACA
25441 GTCATGAGTG AGCTGATCGT GCGCCGTGCG CAGCCCCTGG AGAGGGATGC AAATTTGCAA
25501 GAACAAACAG AGGAGGGCCT ACCCGCAGTT GGCGACGAGC AGCTAGCGCG CTGGCTTCAA
25561 ACGCGCGAGC CTGCCGACTT GGAGGAGCGA CGCAAACTAA TGATGGCCGC AGTGCTCGTT
25621 ACCGTGGAGC TTGAGTGCAT GCAGCGGTTC TTTGCTGACC CGGAGATGCA GCGCAAGCTA
25681 GAGGAAACAT TGCACTACAC CTTTCGACAG GGCTACGTAC GCCAGGCCTG CAAGATCTCC
25741 AACGTGGAGC TCTGCAACCT GGTCTCCTAC CTTGGAATTT TGCACGAAAA CCGCCTTGGG
25801 CAAAACGTGC TTCATTCCAC GCTCAAGGGC GAGGCGCGCC GCGACTACGT CCGCGACTGC
25861 GTTTACTTAT TTCTATGCTA CACCTGGCAG ACGGCCATGG GCGTTTGGCA GCAGTGCTTG
25921 GAGGAGTGCA ACCTCAAGGA GCTGCAGAAA CTGCTAAAGC AAAACTTGAA GGACCTATGG
25981 ACGGCCTTCA ACGAGCGCTC CGTGGCCGCG CACCTGGCGG ACATCATTTT CCCCGAACGC
26041 CTGCTTAAAA CCCTGCAACA GGGTCTGCCA GACTTCACCA GTCAAAGCAT GTTGCAGAAC
26101 TTTAGGAACT TTATCCTAGA GCGCTCAGGA ATCTTGCCCG CCACCTGCTG TGCACTTCCT
26161 AGCGACTTTG TGCCCATTAA GTACCGCGAA TGCCCTCCGC CGCTTTGGGG CCACTGCTAC
26221 CTTCTGCAGC TAGCCAACTA CCTTGCCTAC CACTCTGACA TAATGGAAGA CGTGAGCGGT
26281 GACGGTCTAC TGGAGTGTCA CTGTCGCTGC AACCTATGCA CCCCGCACCG CTCCCTGGTT
26341 TGCAATTCGC AGCTGCTTAA CGAAAGTCAA ATTATCGGTA CCTTTGAGCT GCAGGGTCCC
26401 TCGCCTGACG AAAAGTCCGC GGCTCCGGGG TTGAAACTCA CTCCGGGGCT GTGGACGTCG
26461 GCTTACCTTC GCAAATTTGT ACCTGAGGAC TACCACGCCC ACGAGATTAG GTTCTACGAA
26521 GACCAATCCC GCCCGCCAAA TGCGGAGCTT ACCGCCTGCG TCATTACCCA GGGCCACATT
26581 CTTGGCCAAT TGCAAGCCAT CAACAAAGCC CGCCAAGAGT TTCTGCTACG AAAGGGACGG
26641 GGGGTTTACT TGGACCCCCA GTCCGGCGAG GAGCTCAACC CAATCCCCCC GCCGCCGCAG
26701 CCCTATCAGC AGCAGCCGCG GGCCCTTGCT TCCCAGGATG GCACCCAAAA AGAAGCTGCA
26761 GCTGCCGCCG CCACCCACGG ACGAGGAGGA ATACTGGGAC AGTCAGGCAG AGGAGGTTTT
26821 GGACGAGGAG GAGGAGGACA TGATGGAAGA CTGGGAGAGC CTAGACGAGG AAGCTTCCGA
26881 GGTCGAAGAG GTGTCAGACG AAACACCGTC ACCCTCGGTC GCATTCCCCT CGCCGGCGCC
26941 CCAGAAATCG GCAACCGGTT CCAGCATGGC TACAACCTCC GCTCCTCAGG CGCCGCCGGC
27001 ACTGCCCGTT CGCCGACCCA ACCGTAGATG GGACACCACT GGAACCAGGG CCGGTAAGTC
27061 CAAGCAGCCG CCGCCGTTAG CCCAAGAGCA ACAACAGCGC CAAGGCTACC GCTCATGGCG
27121 CGGGCACAAG AACGCCATAG TTGCTTGCTT GCAAGACTGT GGGGGCAACA TCTCCTTCGC
27181 CCGCCGCTTT CTTCTCTACC ATCACGGCGT GGCCTTCCCC CGTAACATCC TGCATTACTA
27241 CCGTCATCTC TACAGCCCAT ACTGCACCGG CGGCAGCGGC AGCGGCAGCA ACAGCAGCGG
27301 CCACACAGAA GCAAAGGCGA CCGGATAGCA AGACTCTGAC AAAGCCCAAG AAATCCACAG
27361 CGGCGGCAGC AGCAGGAGGA GGAGCGCTGC GTCTGGCGCC CAACGAACCC GTATCGACCC
27421 GCGAGCTTAG AAACAGGATT TTTCCCACTC TGTATGCTAT ATTTCAACAG AGCAGGGGCC
27481 AAGAACAAGA GCTGAAAATA AAAAACAGGT CTCTGCGATC CCTCACCCGC AGCTGCCTGT
27541 ATCACAAAAG CGAAGATCAG CTTCGGCGCA CGCTGGAAGA CGCGGAGGCT CTCTTCAGTA
27601 AATACTGCGC GCTGACTCTT AAGGACTAGT TTCGCGCCCT TTCTCAAATT TAAGCGCGAA
27661 AACTACGTCA TCTCCAGCGG CCACACCCGG CGCCAGCACC TGTCGTCAGC GCCATTATGA
27721 GCAAGGAAAT TCCCACGCCC TACATGTGGA GTTACCAGCC ACAAATGGGA CTTGCGGCTG
27781 GAGCTGCCCA AGACTACTCA ACCCGAATAA ACTACATGAG CGCGGGACCC CACATGATAT
27841 CCCGGGTCAA CGGAATCCGC GCCCACCGAA ACCGAATTCT CTTGGAACAG GCGGCTATTA
27901 CCACCACACC TCGTAATAAC CTTAATCCCC GTAGTTGGCC CGCTGCCCTG GTGTACCAGG
27961 AAAGTCCCGC TCCCACCACT GTGGTACTTC CCAGAGACGC CCAGGCCGAA GTTCAGATGA
28021 CTAACTCAGG GGCGCAGCTT GCGGGCGGCT TTCGTCACAG GGTGCGGTCG CCCGGGCAGG
28081 GTATAACTCA CCTGACAATC AGAGGGCGAG GTATTCAGCT CAACGACGAG TCGGTGAGCT
28141 CCTCGCTTGG TCTCCGTCCG GACGGGACAT TTCAGATCGG CGGCGCCGGC CGTCCTTCAT
28201 TCACGCCTCG TCAGGCAATC CTAACTCTGC AGACCTCGTC CTCTGAGCCG CGCTCTGGAG
28261 GCATTGGAAC TCTGCAATTT ATTGAGGAGT TTGTGCCATC GGTCTACTTT AACCCCTTCT
28321 CGGGACCTCC CGGCCACTAT CCGGATCAAT TTATTCCTAA CTTTGACGCG GTAAAGGACT
28381 CGGCGGACGG CTACGACTGA ATGTTAAGTG GAGAGGCAGA GCAACTGCGC CTGAAACACC
28441 TGGTCCACTG TCGCCGCCAC AAGTGCTTTG CCCGCGACTC CGGTGAGTTT TGCTACTTTG
28501 AATTGCCCGA GGATCATATC GAGGGCCCGG CGCACGGCGT CCGGCTTACC GCCCAGGGAG
28561 AGCTTGCCCG TAGCCTGATT CGGGAGTTTA CCCAGCGCCC CCTGCTAGTT GAGCGGGACA
28621 GGGGACCCTG TGTTCTCACT GTGATTTGCA ACTGTCCTAA CCTTGGATTA CATCAAGATC
28681 TTTGTTGCCA TCTCTGTGCT GAGTATAATA AATACAGAAA TTAAAATATA CTGGGGCTCC
28741 TATCGCCATC CTGTAAACGC CACCGTCTTC ACCCGCCCAA GCAAACCAAG GCGAACCTTA
28801 CCTGGTACTT TTAACATCTC TCCCTCTGTG ATTTACAACA GTTTCAACCC AGACGGAGTG
28861 AGTCTACGAG AGAACCTCTC CGAGCTCAGC TACTCCATCA GAAAAAACAC CACCCTCCTT
28921 ACCTGCCGGG AACGTACGAG TGCGTCACCG GCCGCTGCAC CACACCTACC GCCTGACCGT
28981 AAACCAGACT TTTTCCGGAC AGACCTCAAT AACTCTGTTT ACCAGAACAG GAGGTGAGCT
29041 TAGAAAACCC TTAGGGTATT AGGCCAAAGG CGCAGCTACT GTGGGGTTTA TGAACAATTC
29101 AAGCAACTCT ACGGGCTATT CTAATTCAGG TTTCTCTAGA AATGGACGGA ATTATTACAG
29161 AGCAGCGCCT GCTAGAAAGA CGCAGGGCAG CGGCCGAGCA ACAGCGCATG AATCAAGAGC
29221 TCCAAGACAT GGTTAACTTG CACCAGTGCA AAAGGGGTAT CTTTTGTCTG GTAAAGCAGG
29281 CCAAAGTCAC CTACGACAGT AATACCACCG GACACCGCCT TAGCTACAAG TTGCCAACCA
29341 AGCGTCAGAA ATTGGTGGTC ATGGTGGGAG AAAAGCCCAT TACCATAACT CAGCACTCGG
29401 TAGAAACCGA AGGCTGCATT CACTCACCTT GTCAAGGACC TGAGGATCTC TGCACCCTTA
29461 TTAAGACCCT GTGCGGTCTC AAAGATCTTA TTCCCTTTAA CTAATAAAAA AAAATAATAA
29521 AGCATCACTT ACTTAAAATC AGTTAGCAAA TTTCTGTCCA GTTTATTCAG CAGCACCTCC
29581 TTGCCCTCCT CCCAGCTCTG GTATTGCAGC TTCCTCCTGG CTGCAAACTT TCTCCACAAT
29641 CTAAATGGAA TGTCAGTTTC CTCCTGTTCC TGTCCATCCG CACCCACTAT CTTCATGTTG
29701 TTGCAGATGA AGCGCGCAAG ACCGTCTGAA GATACCTTCA ACCCCGTGTA TCCATATGAC
29761 ACGGAAACCG GTCCTCCAAC TGTGCCTTTT CTTACTCCTC CCTTTGTATC CCCCAATGGG
29821 TTTCAAGAGA GTCCCCCTGG GGTACTCTCT TTGCGCCTAT CCGAACCTCT AGTTACCTCC
29881 AATGGCATGC TTGCGCTCAA AATGGGCAAC GGCCTCTCTC TGGACGAGGC CGGCAACCTT
29941 ACCTCCCAAA ATGTAACCAC TGTGAGCCCA CCTCTCAAAA AAACCAAGTC AAACATAAAC
30001 CTGGAAATAT CTGCACCCCT CACAGTTACC TCAGAAGCCC TAACTGTGGC TGCCGCCGCA
30061 CCTCTAATGG TCGCGGGCAA CACACTCACC ATGCAATCAC AGGCCCCGCT AACCGTGCAC
30121 GACTCCAAAC TTAGCATTGC CACCCAAGGA CCCCTCACAG TGTCAGAAGG AAAGCTAGCC
30181 CTGCAAACAT CAGGCCCCCT CACCACCACC GATAGCAGTA CCCTTACTAT CACTGCCTCA
30241 CCCCCTCTAA CTACTGCCAC TGGTAGCTTG GGCATTGACT TGAAAGAGCC CATTTATACA
30301 CAAAATGGAA AACTAGGACT AAAGTACGGG GCTCCTTTGC ATGTAACAGA CGACCTAAAC
30361 ACTTTGACCG TAGCAACTGG TCCAGGTGTG ACTATTAATA ATACTTCCTT GCAAACTAAA
30421 GTTACTGGAG CCTTGGGTTT TGATTCACAA GGCAATATGC AACTTAATGT AGCAGGAGGA
30481 CTAAGGATTG ATTCTCAAAA CAGACGCCTT ATACTTGATG TTAGTTATCC GTTTGATGCT
30541 CAAAACCAAC TAAATCTAAG ACTAGGACAG GGCCCTCTTT TTATAAACTC AGCCCACAAC
30601 TTGGATATTA ACTACAACAA AGGCCTTTAC TTGTTTACAG CTTCAAACAA TTCCAAAAAG
30661 CTTGAGGTTA ACCTAAGCAC TGCCAAGGGG TTGATGTTTG ACGCTACAGC CATAGCCATT
30721 AATGCAGGAG ATGGGCTTGA ATTTGGTTCA CCTAATGCAC CAAACACAAA TCCCCTCAAA
30781 ACAAAAATTG GCCATGGCCT AGAATTTGAT TCAAACAAGG CTATGGTTCC TAAACTAGGA
30841 ACTGGCCTTA GTTTTGACAG CACAGGTGCC ATTACAGTAG GAAACAAAAA TAATGATAAG
30901 CTAACTTTGT GGACCACACC AGCTCCATCT CCTAACTGTA GACTAAATGC AGAGAAAGAT
30961 GCTAAACTCA CTTTGGTCTT AACAAAATGT GGCAGTCAAA TACTTGCTAC AGTTTCAGTT
31021 TTGGCTGTTA AAGGCAGTTT GGCTCCAATA TCTGGAACAG TTCAAAGTGC TCATCTTATT
31081 ATAAGATTTG ACGAAAATGG AGTGCTACTA AACAATTCCT TCCTGGACCC AGAATATTGG
31141 AACTTTAGAA ATGGAGATCT TACTGAAGGC ACAGCCTATA CAAACGCTGT TGGATTTATG
31201 CCTAACCTAT CAGCTTATCC AAAATCTCAC GGTAAAACTG CCAAAAGTAA CATTGTCAGT
31261 CAAGTTTACT TAAACGGAGA CAAAACTAAA CCTGTAACAC TAACCATTAC ACTAAACGGT
31321 ACACAGGAAA CAGGAGACAC AACTCCAAGT GCATACTCTA TGTCATTTTC ATGGGACTGG
31381 TCTGGCCACA ACTACATTAA TGAAATATTT GCCACATCCT CTTACACTTT TTCATACATT
31441 GCCCAAGAAT AAAGAATCGT TTGTGTTATG TTTCAACGTG TTTATTTTTC AATTGCAGAA
31501 AATTTCGAAT CATTTTTCAT TCAGTAGTAT AGCCCCACCA CCACATAGCT TATACAGATC
31561 ACCGTACCTT AATCAAACTC ACAGAACCCT AGTATTCAAC CTGCCACCTC CCTCCCAACA
31621 CACAGAGTAC ACAGTCCTTT CTCCCCGGCT GGCCTTAAAA AGCATCATAT CATGGGTAAC
31681 AGACATATTC TTAGGTGTTA TATTCCACAC GGTTTCCTGT CGAGCCAAAC GCTCATCAGT
31741 GATATTAATA AACTCCCCGG GCAGCTCACT TAAGTTCATG TCGCTGTCCA GCTGCTGAGC
31801 CACAGGCTGC TGTCCAACTT GCGGTTGCTT AACGGGCGGC GAAGGAGAAG TCCACGCCTA
31861 CATGGGGGTA GAGTCATAAT CGTGCATCAG GATAGGGCGG TGGTGCTGCA GCAGCGCGCG
31921 AATAAACTGC TGCCGCCGCC GCTCCGTCCT GCAGGAATAC AACATGGCAG TGGTCTCCTC
31981 AGCGATGATT CGCACCGCCC GCAGCATAAG GCGCCTTGTC CTCCGGGCAC AGCAGCGCAC
32041 CCTGATCTCA CTTAAATCAG CACAGTAACT GCAGCACAGC ACCACAATAT TGTTCAAAAT
32101 CCCACAGTGC AAGGCGCTGT ATCCAAAGCT CATGGCGGGG ACCACAGAAC CCACGTGGCC
32161 ATCATACCAC AAGCGCAGGT AGATTAAGTG GCGACCCCTC ATAAACACGC TGGACATAAA
32221 CATTACCTCT TTTGGCATGT TGTAATTCAC CACCTCCCGG TACCATATAA ACCTCTGATT
32281 AAACATGGCG CCATCCACCA CCATCCTAAA CCAGCTGGCC AAAACCTGCC CGCCGGCTAT
32341 ACACTGCAGG GAACCGGGAC TGGAACAATG ACAGTGGAGA GCCCAGGACT CGTAACCATG
32401 GATCATCATG CTCGTCATGA TATCAATGTT GGCACAACAC AGGCACACGT GCATACACTT
32461 CCTCAGGATT ACAAGCTCCT CCCGCGTTAG AACCATATCC CAGGGAACAA CCCATTCCTG
32521 AATCAGCGTA AATCCCACAC TGCAGGGAAG ACCTCGCACG TAACTCACGT TGTGCATTGT
32581 CAAAGTGTTA CATTCGGGCA GCAGCGGATG ATCCTCCAGT ATGGTAGCGC GGGTTTCTGT
32641 CTCAAAAGGA GGTAGACGAT CCCTACTGTA CGGAGTGCGC CGAGACAACC GAGATCGTGT
32701 TGGTCGTAGT GTCATGCCAA ATGGAACGCC GGACGTAGTC ATATTTCCTG AAGCAAAACC
32761 AGGTGCGGGC GTGACAAACA GATCTGCGTC TCCGGTCTCG CCGCTTAGAT CGCTCTGTGT
32821 AGTAGTTGTA GTATATCCAC TCTCTCAAAG CATCCAGGCG CCCCCTGGCT TCGGGTTCTA
32881 TGTAAACTCC TTCATGCGCC GCTGCCCTGA TAACATCCAC CACCGCAGAA TAAGCCACAC
32941 CCAGCCAACC TACACATTCG TTCTGCGAGT CACACACGGG AGGAGCGGGA AGAGCTGGAA
33001 GAACCATGTT TTTTTTTTTA TTCCAAAAGA TTATCCAAAA CCTCAAAATG AAGATCTATT
33061 AAGTGAACGC GCTCCCCTCC GGTGGCGTGG TCAAACTCTA CAGCCAAAGA ACAGATAATG
33121 GCATTTGTAA GATGTTGCAC AATGGCTTCC AAAAGGCAAA CGGCCCTCAC GTCCAAGTGG
33181 ACGTAAAGGC TAAACCCTTC AGGGTGAATC TCCTCTATAA ACATTCCAGC ACCTTCAACC
33241 ATGCCCAAAT AATTCTCATC TCGCCACCTT CTCAATATAT CTCTAAGCAA ATCCCGAATA
33301 TTAAGTCCGG CCATTGTAAA AATCTGCTCC AGAGCGCCCT CCACCTTCAG CCTCAAGCAG
33361 CGAATCATGA TTGCAAAAAT TCAGGTTCCT CACAGACCTG TATAAGATTC AAAAGCGGAA
33421 CATTAACAAA AATACCGCGA TCCCGTAGGT CCCTTCGCAG GGCCAGCTGA ACATAATCGT
33481 GCAGGTCTGC ACGGACCAGC GCGGCCACTT CCCCGCCAGG AACCTTGACA AAAGAACCCA
33541 CACTGATTAT GACACGCATA CTCGGAGCTA TGCTAACCAG CGTAGCCCCG ATGTAAGCTT
33601 TGTTGCATGG GCGGCGATAT AAAATGCAAG GTGCTGCTCA AAAAATCAGG CAAAGCCTCG
33661 CGCAAAAAAG AAAGCACATC GTAGTCATGC TCATGCAGAT AAAGGCAGGT AAGCTCCGGA
33721 ACCACCACAG AAAAAGACAC CATTTTTCTC TCAAACATGT CTGCGGGTTT CTGCATAAAC
33781 ACAAAATAAA ATAACAAAAA AACATTTAAA CATTAGAAGC CTGTCTTACA ACAGGAAAAA
33841 CAACCCTTAT AAGCATAAGA CGGACTACGG CCATGCCGGC GTGACCGTAA AAAAACTGGT
33901 CACCGTGATT AAAAAGCACC ACCGACAGCT CCTCGGTCAT GTCCGGAGTC ATAATGTAAG
33961 ACTCGGTAAA CACATCAGGT TGATTCACAT CGGTCAGTGC TAAAAAGCGA CCGAAATAGC
34021 CCGGGGGAAT ACATACCCGC AGGCGTAGAG ACAACATTAC AGCCCCCATA GGAGGTATAA
34081 CAAAATTAAT AGGAGAGAAA AACACATAAA CACCTGAAAA ACCCTCCTGC CTAGGCAAAA
34141 TAGCACCCTC CCGCTCCAGA ACAACATACA GCGCTTCCAC AGCGGCAGCC ATAACAGTCA
34201 GCCTTACCAG TAAAAAAGAA AACCTATTAA AAAAACACCA CTCGACACGG CACCAGCTCA
34261 ATCAGTCACA GTGTAAAAAA GGGCCAAGTG CAGAGCGAGT ATATATAGGA CTAAAAAATG
34321 ACGTAACGGT TAAAGTCCAC AAAAAACACC CAGAAAACCG CACGCGAACC TACGCCCAGA
34381 AACGAAAGCC AAAAAACCCA CAACTTCCTC AAATCGTCAC TTCCGTTTTC CCACGTTACG
34441 TCACTTCCCA TTTTAAGAAA ACTACAATTC CCAACACATA CAAGTTACTC CGCCCTAAAA
34501 CCTACGTCAC CCGCCCCGTT CCCACGCCCC GCGCCACGTC ACAAACTCCA CCCCCTCATT
34561 ATCATATTGG CTTCAATCCA AAATAAGGTA TATTATTGAT GATGTTAATT AATTTAAATC
34621 CGCATGCGAT ATCGAGCTCT CCCGGGAATT CGGATCTGCG ACGCGAGGCT GGATGGCCTT
34681 CCCCATTATG ATTCTTCTCG CTTCCGGCGG CATCGGGATG CCCGCGTTGC AGGCCATGCT
34741 GTCCAGGCAG GTAGATGACG ACCATCAGGG ACAGCTTCAC GGCCAGCAAA AGGCCAGGAA
34801 CCGTAAAAAG GCCGCGTTGC TGGCGTTTTT CCATAGGCTC CGCCCCCCTG ACGAGCATCA
34861 CAAAAATCGA CGCTCAAGTC AGAGGTGGCG AAACCCGACA GGACTATAAA GATACCAGGC
34921 GTTTCCCCCT GGAAGCTCCC TCGTGCGCTC TCCTGTTCCG ACCCTGCCGC TTACCGGATA
34981 CCTGTCCGCC TTTCTCCCTT CGGGAAGCGT GGCGCTTTCT CAATGCTCAC GCTGTAGGTA
35041 TCTCAGTTCG GTGTAGGTCG TTCGCTCCAA GCTGGGCTGT GTGCACGAAC CCCCCGTTCA
35101 GCCCGACCGC TGCGCCTTAT CCGGTAACTA TCGTCTTGAG TCCAACCCGG TAAGACACGA
35161 CTTATCGCCA CTGGCAGCAG CCACTGGTAA CAGGATTAGC AGAGCGAGGT ATGTAGGCGG
35221 TGCTACAGAG TTCTTGAAGT GGTGGCCTAA CTACGGCTAC ACTAGAAGGA CAGTATTTGG
35281 TATCTGCGCT CTGCTGAAGC CAGTTACCTT CGGAAAAAGA GTTGGTAGCT CTTGATCCGG
35341 CAAACAAACC ACCGCTGGTA GCGGTGGTTT TTTTGTTTGC AAGCAGCAGA TTACGCGCAG
35401 AAAAAAAGGA TCTCAAGAAG ATCCTTTGAT CTTTTCTACG GGGTCTGACG CTCAGTGGAA
35461 CGAAAACTCA CGTTAAGGGA TTTTGGTCAT GAGATTATCA AAAAGGATCT TCACCTAGAT
35521 CCTTTTAAAT CAATCTAAAG TATATATGAG TAAACTTGGT CTGACAGTTA CCAATGCTTA
35581 ATCAGTGAGG CACCTATCTC AGCGATCTGT CTATTTCGTT CATCCATAGT TGCCTGACTC
35641 CCCGTCGTGT AGATAACTAC GATACGGGAG GGCTTACCAT CTGGCCCCAG TGCTGCAATG
35701 ATACCGCGAG ACCCACGCTC ACCGGCTCCA GATTTATCAG CAATAAACCA GCCAGCCGGA
35761 AGGGCCGAGC GCAGAAGTGG TCCTGCAACT TTATCCGCCT CCATCCAGTC TATTAATTGT
35821 TGCCGGGAAG CTAGAGTAAG TAGTTCGCCA GTTAATAGTT TGCGCAACGT TGTTGCCATT
35881 GNTGCAGGCA TCGTGGTGTC ACGCTCGTCG TTTGGTATGG CTTCATTCAG CTCCGGTTCC
35941 CAACGATCAA GGCGAGTTAC ATGATCCCCC ATGTTGTGCA AAAAAGCGGT TAGCTCCTTC
36001 GGTCCTCCGA TCGTTGTCAG AAGTAAGTTG GCCGCAGTGT TATCACTCAT GGTTATGGCA
36061 GCACTGCATA ATTCTCTTAC TGTCATGCCA TCCGTAAGAT GCTTTTCTGT GACTGGTGAG
36121 TACTCAACCA AGTCATTCTG AGAATAGTGT ATGCGGCGAC CGAGTTGCTC TTGCCCGGCG
36181 TCAACACGGG ATAATACCGC GCCACATAGC AGAACTTTAA AAGTGCTCAT CATTGGAAAA
36241 CGTTCTTCGG GGCGAAAACT CTCAAGGATC TTACCGCTGT TGAGATCCAG TTCGATGTAA
36301 CCCACTCGTG CACCCAACTG ATCTTCAGCA TCTTTTACTT TCACCAGCGT TTCTGGGTGA
36361 GCAAAAACAG GAAGGCAAAA TGCCGCAAAA AAGGGAATAA GGGCGACACG GAAATGTTGA
36421 ATACTCATAC TCTTCCTTTT TCAATATTAT TGAAGCATTT ATCAGGGTTA TTGTCTCATG
36481 AGCGGATACA TATTTGAATG TATTTAGAAA AATAAACAAA TAGGGGTTCC GCGCACATTT
36541 CCCCGAAAAG TGCCACCTGA CGTCTAAGAA ACCATTATTA TCATGACATT AACCTATAAA
36601 AATAGGCGTA TCACGAGGCC CTTTCGTCTT CAAGGATCCG AATTCCCGGG AGAGCTCGAT
36661 ATCGCATGCG GATTTAAATT AATTAA
//

载体质粒图谱pdf版和相关资料下载

载体应用举例

分享到:

全部载体分类

相关载体

相关文章

相关问答

Copyright © 20012-2013 BIOFENG. 生物风 版权所有 Powered by Biofeng
欢迎您的访问和咨询....